SLC25A14 (NM_001282198) Human Untagged Clone

CAT#: SC335124

SLC25A14 (untagged) - Human solute carrier family 25 (mitochondrial carrier, brain), member 14 (SLC25A14), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC25A14
• Synonyms: BMCP1; UCP5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335124 representing NM_001282198.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTCTGGTCTGAATTGGAAACCCTTTGTATATGGCGGCCTTGCCTCTATCGTGGCTGAGTTTGGGACT
  TTCCCTGTGGACCTTACCAAAACACGACTTCAGGTTCAAGGCCAAAGCATTGATGCCCGTTTCAAAGAG
  ATAAAATATAGAGGGATGTTCCATGCGCTGTTTCGCATCTGTAAAGAGGAAGGTGTATTGGCTCTCTAT
  TCAGGAATTGCTCCTGCGTTGCTAAGACAAGCATCATATGGCACCATTAAAATTGGGATTTACCAAAGC
  TTGAAGCGCTTATTCGTAGAACGTTTAGAAGATGAAACTCTTTTAATTAATATGATCTGTGGGGTAGTG
  TCAGGAGTGATATCTTCCACTATAGCCAATCCCACCGATGTTCTAAAGATTCGAATGCAGGCTCAAGGA
  AGCTTGTTCCAAGGGAGCATGATTGGAAGCTTTATCGATATATACCAACAAGAAGGCACCAGGGGTCTG
  TGGAGGGGTGTGGTTCCAACTGCTCAGCGTGCTGCCATCGTTGTAGGAGTAGAGCTACCAGTCTATGAT
  ATTACTAAGAAGCATTTAATATTGTCAGGAATGATGGGCGATACAATTTTAACTCACTTCGTTTCCAGC
  TTTACATGTGGTTTGGCTGGGGCTCTGGCCTCCAACCCGGTTGATGTGGTTCGAACTCGCATGATGAAC
  CAGAGGGCAATCGTGGGACATGTGGATCTCTATAAGGGCACTGTTGATGGTATTTTAAAGATGTGGAAA
  CATGAGGGCTTTTTTGCACTCTATAAAGGATTTTGGCCAAACTGGCTTCGGCTTGGACCCTGGAACATC
  ATTTTTTTTATTACATACGAGCAGCTAAAGAGGCTTCAAATCTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282198
• Insert Size: 873 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282198.1
• RefSeq Size: 1409 bp
• RefSeq ORF: 873 bp
• Locus ID: 9016
• UniProt ID: O95258
• Cytogenetics: Xq26.1
• Protein Families: Druggable Genome
• MW: 32.5 kDa
• Gene Summary: Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). Uncoupling proteins separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. Uncoupling proteins facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. This gene is widely expressed in many tissues with the greatest abundance in brain and testis. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (4) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1.