MBD3 (NM_001281453) Human Untagged Clone

CAT#: SC335127

MBD3 (untagged) - Human methyl-CpG binding domain protein 3 (MBD3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MBD3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335127 representing NM_001281453.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAGCGGAAGAGGTGGGAGTGCCCGGCGCTCCCGCAGGGCTGGGAGAGGGAAGAAGTGCCCAGAAGG
  TCGGGGCTGTCGGCCGGCCACAGGGATGTCTTTTACTATAGCCCGAGCGGGAAGAAGTTCCGCAGCAAG
  CCGCAGCTGGCGCGCTACCTGGGCGGCTCCATGGACCTGAGCACCTTCGACTTCCGCACGGGCAAGATG
  CTGATGAGCAAGATGAACAAGAGCCGCCAGCGCGTGCGCTACGACTCCTCCAACCAGGTCAAGGGCAAG
  CCCGACCTGAACACGGCGCTGCCCGTGCGCCAGACGGCGTCCATCTTCAAGCAGCCGGTGACCAAGATT
  ACCAACCACCCCAGCAACAAGGTCAAGAGCGACCCGCAGAAGGCGGTGGACCAGCCGCGCCAGCTCTTC
  TGGGAGAAGAAGCTGAGCGGCCTGAACGCCTTCGACATTGCTGAGGAGCTGGTCAAGACCATGGACCTC
  CCCAAGGGCCTGCAGGGGGTGGGACCTGGCTGCACGGATGAGACGCTGCTGTCGGCCATCGCCAGCGCC
  CTGCACACTAGCACCATGCCCATCACGGGACAGCTCTCGGCCGCCGTGGAGAAGAACCCCGGCGTATGG
  CTCAACACCACGCAGCCCCTGTGCAAAGCCTTCATGGTGACCGACGAGGACATCAGGAAGCAGGAAGAG
  CTGGTGCAGCAGGTGCGGAAGCGGCTGGAGGAGGCGCTGATGGCCGACATGCTGGCGCACGTGGAGGAG
  CTGGCCCGTGACGGGGAGGCGCCGCTGGACAAGGCCTGCGCTGAGGACGACGACGAGGAAGACGAGGAG
  GAGGAGGAGGAGGAGCCCGACCCGGACCCGGAGATGGAGCACGTCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001281453
• Insert Size: 876 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001281453.1
• RefSeq Size: 2513 bp
• RefSeq ORF: 876 bp
• Locus ID: 53615
• UniProt ID: O95983
• Cytogenetics: 19p13.3
• Protein Families: Druggable Genome, Transcription Factors
• MW: 32.8 kDa
• Gene Summary: DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. This gene belongs to a family of nuclear proteins which are characterized by the presence of a methyl-CpG binding domain (MBD). The encoded protein is a subunit of the NuRD, a multisubunit complex containing nucleosome remodeling and histone deacetylase activities. Unlike the other family members, the encoded protein is not capable of binding to methylated DNA. The protein mediates the association of metastasis-associated protein 2 with the core histone deacetylase complex. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).