ZDHHC20 (NM_001286638) Human Untagged Clone

CAT#: SC335139

ZDHHC20 (untagged) - Human zinc finger, DHHC-type containing 20 (ZDHHC20), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZDHHC20
• Synonyms: 4933421L13Rik; DHHC-20; DHHC20
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335139 representing NM_001286638.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTTTGTATGGTCCTATTGGATGACAATTTTCACATCTCCCGCTTCCCCCTCCAAAGAGTTCTACTTG
  TCCAATTCTGAAAAGGAACGTTATGAAAAAGAATTCAGCCAAGAAAGACAACAAGAAATTTTGAGAAGA
  GCAGCAAGAGCTTTACCTATCTATACCACATCAGCTTCAAAAACTATCAGATATTGTGAAAAATGTCAG
  CTGATTAAACCTGATCGGGCGCATCACTGCTCAGCCTGTGACTCATGTATTCTTAAGATGGATCATCAC
  TGTCCTTGGGTGAATAACTGTGTGGGATTTTCTAATTACAAATTCTTCCTGCTGTTTTTATTGTATTCC
  CTATTATATTGCCTTTTCGTGGCTGCAACAGTTTTAGAGTACTTTATAAAATTTTGGACGAATGAACTG
  ACAGATACACGTGCAAAATTCCACGTACTTTTTCTTTTCTTTGTGTCTGCAATGTTCTTCATCAGCGTC
  CTCTCACTTTTCAGCTACCACTGCTGGCTAGTTGGAAAAAATAGAACAACAATAGAATCATTCCGCGCA
  CCCACGTTTTCATACGGACCTGATGGAAATGGTTTCTCTCTTGGATGCAGTAAAAATTGGAGACAAGTC
  TTTGGTGATGAAAAGAAATATTGGCTACTTCCAATATTTTCAAGCTTGGGTGATGGTTGCAGTTTTCCA
  ACTCGCCTTGTGGGGATGGATCCAGAACAAGCTTCTGTTACAAACCAGAATGAGTATGCCAGAAGTAGT
  GGCTCAAATCAACCTTTTCCTATCAAACCACTTAGTGAATCAAAAAACCGCTTGTTGGACAGTGAATCT
  CAGTGGCTGGAGAATGGAGCTGAAGAAGGCATCGTCAAATCAGGTGTATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286638
• Insert Size: 879 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286638.1
• RefSeq Size: 5333 bp
• RefSeq ORF: 879 bp
• Locus ID: 253832
• UniProt ID: Q5W0Z9
• Cytogenetics: 13q12.11
• Protein Families: Transmembrane
• MW: 33.7 kDa
• Gene Summary: Catalyzes palmitoylation of Cys residues on target proteins (PubMed:27153536, PubMed:29326245). Catalyzes palmitoylation of Cys residues in the cytoplasmic C-terminus of EGFR, and modulates the duration of EGFR signaling by modulating palmitoylation-dependent EGFR internalization and degradation (PubMed:27153536). Has a preference for acyl-CoA with C16 fatty acid chains (PubMed:29326245). Can also utilize acyl-CoA with C14 and C18 fatty acid chains (PubMed:29326245).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains multiple differences in the coding region, compared to variant 1, including initiation of translation at a downstream in-frame start codon. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.