Sprouty 4 (SPRY4) (NM_001293290) Human Untagged Clone

CAT#: SC335186

SPRY4 (untagged) - Human sprouty homolog 4 (Drosophila) (SPRY4), transcript variant 4


  "NM_001293290" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SPRY4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPRY4
Synonyms HH17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001293290, the custom clone sequence may differ by one or more nucleotides


ATGGAGCCCCCGATCCCACAGAGCGCCCCCTTGACTCCCAACTCAGTCATGGTCCAGCCCCTTCTTGACA
GCCGGATGTCCCACAGCCGGCTCCAGCACCCACTCACCATCCTACCCATTGACCAGGTGAAGACCAGCCA
TGTGGAGAATGACTACATAGACAACCCTAGCCTGGCCCTGACCACCGGCCCAAAGCGGACCCGGGGCGGG
GCCCCAGAGCTGGCCCCGACGCCCGCCCGCTGTGACCAGGATGTCACCCACCATTGGATCTCCTTCAGCG
GGCGCCCCAGCTCTGTGAGCAGCAGCAGCAGCACATCCTCTGACCAACGGCTCTTAGACCACATGGCACC
ACCACCCGTGGCTGACCAGGCCTCACCAAGGGCTGTGCGCATCCAGCCCAAGGTGGTCCACTGCCAGCCG
CTGGACCTCAAGGGCCCGGCGGTCCCACCCGAGCTGGACAAGCACTTCTTGCTGTGCGAGGCCTGTGGGA
AGTGTAAATGCAAGGAGTGTGCATCCCCCCGGACGTTGCCTTCCTGCTGGGTCTGCAACCAGGAGTGCCT
GTGCTCAGCCCAGACTCTGGTCAACTATGGCACGTGCATGTGTTTGGTGCAGGGCATCTTCTACCACTGC
ACGAATGAGGACGATGAGGGCTCCTGCGCTGACCACCCCTGCTCCTGCTCCCGCTCCAACTGCTGCGCCC
GCTGGTCCTTCATGGGTGCTCTCTCCGTGGTGCTGCCCTGCCTGCTCTGCTACCTGCCTGCCACCGGCTG
CGTGAAGCTGGCCCAGCGTGGCTACGACCGTCTGCGCCGCCCTGGTTGCCGCTGCAAGCACACGAACAGC
GTCATCTGCAAAGCAGCCAGCGGGGATGCCAAGACCAGCAGGCCCGACAAGCCTTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001293290
ORF Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001293290.1, NP_001280219.1
RefSeq Size 5257
RefSeq ORF 900
Locus ID 81848
Protein Pathways Jak-STAT signaling pathway
Gene Summary This gene encodes a member of a family of cysteine- and proline-rich proteins. The encoded protein is an inhibitor of the receptor-transduced mitogen-activated protein kinase (MAPK) signaling pathway. Activity of this protein impairs the formation of active GTP-RAS. Nucleotide variation in this gene has been associated with hypogonadotropic hypogonadism 17 with or without anosmia. Alternative splicing results in a multiple transcript variants. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 2, 3, and 4 encode the same isoform (2). Sequence Note: The RefSeq transcript was derived from the reference genome assembly. The genomic coordinates were determined from alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.