CACNA2D1 (NM_001302890) Human Untagged Clone

CAT#: SC335255

CACNA2D1 (untagged) - Human calcium channel, voltage-dependent, alpha 2/delta subunit 1 (CACNA2D1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CACNA2D1
• Synonyms: CACNA2; CACNL2A; CCHL2A; LINC01112; lncRNA-N3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302890, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCTGGCTGCCTGCTGGCCTTGACTCTGACACTTTTCCAATCTTTGCTCATCGGCCCCTCGTCGG
  AGGAGCCGTTCCCTTCGGCCGTCACTATCAAATCATGGGTGGATAAGATGCAAGAAGACCTTGTCACACT
  GGCAAAAACAGCAAGTGGAGTCAATCAGCTTGTTGATATTTATGAGAAATATCAAGATTTGTATACTGTG
  GAACCAAATAATGCACGCCAGCTGGTAGAAATTGCAGCCAGGGATATTGAGAAACTTCTGAGCAACAGAT
  CTAAAGCCCTGGTGCGCCTGGCATTGGAAGCGGAGAAAGTTCAAGCAGCTCACCAGTGGAGAGAAGATTT
  TGCAAGCAATGAAGTTGTCTACTACAATGCAAAGGATGATCTCGATCCTGAGAAAAATGACAGTGAGCCA
  GGCAGCCAGAGGATAAAACCTGTTTTCATTGAAGATGCTAATTTTGGACGACAAATATCTTATCAGCACG
  CAGCAGTCCATATTCCTACTGACATCTATGAGGGCTCAACAATTGTGTTAAATGAACTCAACTGGACAAG
  TGCCTTAGATGAAGTTTTCAAAAAGAATCGCGAGGAAGACCCTTCATTATTGTGGCAGGTTTTTGGCAGT
  GCCACTGGCCTAGCTCGATATTATCCAGCTTCACCATGGGTTGATAATAGTAGAACTCCAAATAAGATTG
  ACCTTTATGATGTACGCAGAAGACCATGGTACATCCAAGGAGCTGCATCTCCTAAAGACATGCTTATTCT
  GGTGGATGTGAGTGGAAGTGTTAGTGGATTGACACTTAAACTGATCCGAACATCTGTCTCCGAAATGTTA
  GAAACCCTCTCAGATGATGATTTCGTGAATGTAGCTTCAGATAGTAAAGAGATTTCTCCTTCTCCCGAAG
  AGATTTTCAATGCAGAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302890
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302890.1, NP_001289819.1
• RefSeq Size: 1538 bp
• RefSeq ORF: 930 bp
• Locus ID: 781
• Cytogenetics: 7q21.11
• Protein Families: Druggable Genome, Ion Channels: Other
• Protein Pathways: Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
• Gene Summary: 'The preproprotein encoded by this gene is cleaved into multiple chains that comprise the alpha-2 and delta subunits of the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. Mutations in this gene can cause cardiac deficiencies, including Brugada syndrome and short QT syndrome. Alternate splicing results in multiple transcript variants, some of which may lack the delta subunit portion. [provided by RefSeq, Nov 2014]'
  Transcript Variant: This variant (2) lacks multiple 3' exons and contains an alternate 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. This isoform lacks the entire delta chain and a large portion of the alpha-2 chain.