PCYT2 (NM_001282203) Human Untagged Clone

CAT#: SC335261

PCYT2 (untagged) - Human phosphate cytidylyltransferase 2, ethanolamine (PCYT2), transcript variant 5


  "NM_001282203" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PCYT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PCYT2
Synonyms ET
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282203, the custom clone sequence may differ by one or more nucleotides


ATGGTGCAGGCCATCAAATGGGTGGACGAGGTGGTGCCAGCGGCTCCCTACGTCACTACACTAGAGACCC
TGGACAAATACAACTGTGACTTCTGTGTTCACGGCAATGACATCACCCTGACTGTAGATGGCCGGGACAC
CTATGAGGAAGTAAAGCAGGCTGGGAGGTACAGAGAATGCAAGCGCACGCAAGGGGTGTCCACCACAGAC
CTCGTGGGCCGCATGCTGCTGGTAACCAAAGCCCATCACAGCAGCCAGGAGATGTCCTCTGAGTACCGGG
AGTATGCAGACAGTTTTGGCAAGTGCCCTGGTGGGCGGAACCCCTGGACCGGGGTATCCCAGTTCCTGCA
GACATCTCAGAAGATCATCCAGTTTGCTTCTGGGAAGGAGCCCCAGCCAGGGGAGACAGTCATCTATGTG
GCTGGTGCCTTCGACCTGTTCCACATCGGGCATGTGGACTTCCTGGAGAAGGTGCACAGGCTGGCAGAGA
GGCCCTACATCATCGCGGGCTTACACTTTGACCAGGAGGTCAATCACTACAAGGGGAAGAACTACCCCAT
CATGAATCTGCATGAACGGACTCTGAGCGTGCTGGCCTGCCGGTACGTGTCAGAAGTGGTGATTGGAGCC
CCGTACGCGGTCACAGCAGAGCTCCTAAGTCACTTCAAGGTGGACCTGGTGTGTCACGGCAAGACAGAAA
TTATCCCTGACAGGGATGGCTCCGACCCATACCAGGAGCCCAAGAGAAGGGGCATCTTCCGTCAGATTGA
CAGTGGCAGCAACCTCACCACAGACCTCATCGTCCAGCGGATCATCACCAACAGGTTGGAGTATGAGGCG
CGAAACCAGAAGAAGGAAGCCAAGGAGCTGGCCTTCCTGGAGGCTGCCAGGCAGCAGGCGGCACAGCCCC
TGGGGGAGCGCGATGGTGACTTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001282203
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282203.1, NP_001269132.1
RefSeq Size 3653 bp
RefSeq ORF 936 bp
Locus ID 5833
Cytogenetics 17q25.3
Protein Pathways Glycerophospholipid metabolism, Metabolic pathways
Gene Summary 'This gene encodes an enzyme that catalyzes the formation of CDP-ethanolamine from CTP and phosphoethanolamine in the Kennedy pathway of phospholipid synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]'
Transcript Variant: This variant (5) differs in the 5' UTR and has many differences in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 1. Both variants 4 and 5 encode the same isoform (4). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.