C2 (NM_001282459) Human Untagged Clone

CAT#: SC335371

C2 (untagged) - Human complement component 2 (C2), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C2
• Synonyms: ARMD14; CO2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282459, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCCCACTGATGGTTCTTTTTTGCCTGCTGTTCCTGTACCCAGGTCTGGCAGACTCGGCTCCCTCCT
  GCCCTCAGAACGTGAATATCTCGGGTGGCACCTTCACCCTCAGCCATGGCTGGGCTCCTGGGAGCCTTCT
  CACCTACTCCTGCCCCCAGGGCCTGTACCCATCCCCAGCATCACGGCTGTGCAAGAGCAGCGGACAGTGG
  CAGACCCCAGGAGCCACCCGGTCTCTGTCTAAGGCGGTCTGCAAACCTGTGCGCTGTCCAGCCCCTGTCT
  CCTTTGAGAATGGCATTTATACCCCACGGCTGGGGTCCTATCCCGTGGGTGGCAATGTGAGCTTCGAGTG
  TGAGGATGGCTTCATATTGCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGGCATGTGGGATGGAGAA
  ACAGCTGTGTGTGATAATGGGGCTGGCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGGACAG
  GCTTCCGCTTTGGTCATGGGGACAAGGTCCGCTATCGCTGCTCCTCGAATCTTGTGCTCACGGGGTCTTC
  GGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTGGAACGGAGCCCATCTGCCGCCAACCCTACTCTTAT
  GACTTCCCTGAGGACGTGGCCCCTGCCCTGGGCACTTCCTTCTCCCACATGCTTGGGGCCACCAATCCCA
  CCCAGAAGACAAAGGAAAGCCTGGGCCGTAAAATCCAAATCCAGCGCTCTGGTCATCTGAACCTCTACCT
  GCTCCTGGACTGTTCGCAGAGTGTGTCGGAAAATGACTTTCTCATCTTCAAGGAGAGCGCCTCCCTCATG
  GTGGACAGGGTCAGGAATCAGGAGTCTGCCTGCAGCAGAGGCCTTCCTGTGCTCACTATCTCTCTCTGTC
  TCCTTCCCCTCCTCAGAACCCCACTCACAGCCCACCTCCTCCAAGAAGTCTTCTCAGATTATACTCATGC
  CATGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282459
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282459.1, NP_001269388.1
• RefSeq Size: 1916 bp
• RefSeq ORF: 987 bp
• Locus ID: 717
• Cytogenetics: 6p21.33
• Protein Families: Druggable Genome, Protease, Secreted Protein
• Protein Pathways: Complement and coagulation cascades, Systemic lupus erythematosus
• Gene Summary: 'Component C2 is a serum glycoprotein that functions as part of the classical pathway of the complement system. Activated C1 cleaves C2 into C2a and C2b. The serine proteinase C2a then combines with complement factor 4b to create the C3 or C5 convertase. Deficiency of C2 has been reported to associated with certain autoimmune diseases and SNPs in this gene have been associated with altered susceptibility to age-related macular degeneration. This gene localizes within the class III region of the MHC on the short arm of chromosome 6. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described in publications but their full-length sequence has not been determined.[provided by RefSeq, Mar 2009]'
  Transcript Variant: This variant (6) uses an alternate 3' exon structure, and thus differs in the 3' coding region and 3' UTR compared to variant 1. It encodes isoform 6 which is shorter and has a distinct C-terminus, compared to isoform 1.