TXNRD2 (NM_001282512) Human Untagged Clone

CAT#: SC335453

TXNRD2 (untagged) - Human thioredoxin reductase 2 (TXNRD2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TXNRD2
• Synonyms: GCCD5; SELZ; TR; TR-BETA; TR3; TRXR2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282512, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCAATGGCGGTGGCGCTGCGGGGATTAGGAGGGCGCTTCCGGTGGCGGACGCAGGCCGTGGCGG
  GCGGGGTGCGGGGCGCGGCGCGGGGCGCAGCAGCAGGTCAGCGGGACTATGATCTCCTGGTGGTCGGCGG
  GGGATCTGGTGGCCTGGCTTGTGCCAAGGAGGCCGCCCAGCTGGGAAGGAAGGTGGCCGTGGTGGACTAC
  GTGGAACCTTCTCCCCAAGGCACCCGGTGGGGCCTCGGCGGCACCTGCGTCAACGTGGGCTGCATCCCCA
  AGAAGCTGATGCACCAGGCGGCACTGCTGGGAGGCCTGATCCAAGATGCCCCCAACTATGGCTGGGAGGT
  GGCCCAGCCCGTGCCGCATGACTGGAGGAAGATGGCAGAAGCTGTTCAAAATCACGTGAAATCCTTGAAC
  TGGGGCCACCGTGTCCAGCTTCAGGACAGAAAAGTCAAGTACTTTAACATCAAAGCCAGCTTTGTTGACG
  AGCACACGGTTTGCGGCGTTGCCAAAGGTGGGAAAGAGATTCTGCTGTCAGCCGATCACATCATCATTGC
  TACTGGAGGGCGGCCGAGATACCCCACGCACATCGAAGGTGCCTTGGAATATGGAATCACAAGTGATGAC
  ATCTTCTGGCTGAAGGAATCCCCTGGAAAAACGTTGGTGGTCGGGGCCAGCTATGTGGCCCTGGAGTGTG
  CTGGCTTCCTCACCGGGATTGGGCTGGACACCACCATCATGATGCGCAGCATCCCCCTCCGCGGCTTCGA
  CCAGCAAATGTCCTCCATGGTCATAGAGCACATGGCATCTCATGGCACCCGGTTCCTGAGGGGCTGTGCC
  CCCTCGCGGGTCAGGAGGCTCCCTGATGGCCAGCTGCAGGTCACCTGGGAGGACAGCACCACCGGCAAGG
  AGGACACGGGCACCTTTGACACCGTCCTGTGGGCCATAGCACCTTGCATCTCTGCGTGTCTCCCCACCAC
  CGTGGGACATGCTGGAAAAAACCAGAGAAGAGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282512
• ORF Size: 1017 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282512.1, NP_001269441.1
• RefSeq Size: 2081
• RefSeq ORF: 1017
• Locus ID: 10587
• Protein Families: Druggable Genome
• Protein Pathways: Pyrimidine metabolism
• Gene Summary: The protein encoded by this gene belongs to the pyridine nucleotide-disulfide oxidoreductase family, and is a member of the thioredoxin (Trx) system. Three thioredoxin reductase (TrxR) isozymes are found in mammals. TrxRs are selenocysteine-containing flavoenzymes, which reduce thioredoxins, as well as other substrates, and play a key role in redox homoeostasis. This gene encodes a mitochondrial form important for scavenging reactive oxygen species in mitochondria. It functions as a homodimer containing FAD, and selenocysteine (Sec) at the active site. Sec is encoded by UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants encoding different isoforms, including a few localized in the cytosol and some lacking the C-terminal Sec residue, have been found for this gene. [provided by RefSeq, Jun 2017]
  Transcript Variant: This variant (5) lacks several exons in the 3' coding region, and contains an alternate 3' terminal exon compared to variant 1. The resulting isoform (5) is shorter, with a distinct C-terminus (lacking selenocysteine) compared to isoform 1.