BOULE (BOLL) (NM_001284361) Human Untagged Clone

CAT#: SC335463

BOLL (untagged) - Human boule-like RNA-binding protein (BOLL), transcript variant 4


  "NM_001284361" in other vectors (1)

Reconstitution Protocol

USD 350.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "BOLL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BOLL
Synonyms BOULE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001284361, the custom clone sequence may differ by one or more nucleotides


ATGCAAACATCAAACCAGATGCAAACAGATTCATTATCTCCATCCCCTAATCCTGTGTCACCTGTGCCTT
TGAATAACCCAACAAGTGCCCCAAGATATGGAACAGTGATCCCTAATCGCATCTTTGTAGGAGGAATTGA
TTTTAAGACAAACGAAAGTGATTTAAGAAAATTTTTTTCCCAGTATGGGTCTGTGAAAGAAGTGAAGATT
GTAAATGACAGAGCTGGAGTATCCAAAGGGTATGGTTTCGTCACTTTTGAAACACAAGAAGATGCACAAA
AAATTTTACAAGAGGCTGAAAAACTTAATTATAAGGATAAGAAGCTGAACATTGGTCCAGCAATAAGAAA
ACAACAAGTAGGGATCCCTCGTTCTAGTATAATGCCAGCAGCTGGAACAATGTATCTAACAACTTCAACT
GGATATCCTTATACTTACCATAATGGTGTTGCTTATTTTCATACTCCAGAGGTAACTTCGGTCCCACCGC
CTTGGCCTTCACGTTCTGTATGTAGCTCCCCTGTGATGGTAGCTCAGCCCATTTATCAGCAACCTGCATA
TCACTACCAGGGAATTAAACAATGTCATACAAGAAGATGGATGGACTCTTTGCTTCCTTTTACCAAATGT
GATGAGGCCACCACACAGTATTTACCAGGACAGTGGCAGTGGAGTGTTCCTCAGCCTTCTGCCTCTTCTG
CTCCATTCTTATACCTGCAACCTTCTGAGGTTATTTATCAACCAGTGGAAATTGCACAGGATGGTGGATG
TGTTCCTCCTCCACTGTCTCTGATGGAAACTTCAGTTCCAGAGCCTTATTCTGATCATGGAGTTCAAGCA
ACATATCACCAGGTTTATGCTCCAAGTGCCATCACTATGCCTGCGCCTGTGATGCAGCCTGAGCCAATTA
AATGTGGAGCATTCATTATTAAGACAATTGGGCAGCTCTATTCCAGCTCAACTGATTTCTTGTCCAATGA
TCCTTGCGTGGCCGAGATCCAGCTTCAACGAACCAGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001284361
ORF Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001284361.1, NP_001271290.1
RefSeq Size 2987
RefSeq ORF 1020
Locus ID 66037
Gene Summary This gene belongs to the DAZ gene family required for germ cell development. It encodes an RNA-binding protein which is more similar to Drosophila Boule than to human proteins encoded by genes DAZ (deleted in azoospermia) or DAZL (deleted in azoospermia-like). Loss of this gene function results in the absence of sperm in semen (azoospermia). Histological studies demonstrated that the primary defect is at the meiotic G2/M transition. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the UTRs and has multiple coding region differences one of which causes a frameshift, compared to variant 1. These differences also cause translation initiation at an alternate AUG. The enocoded isoform (4) is longer and has distinct N- and C-termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.