SHMT1 (NM_001281786) Human Untagged Clone

CAT#: SC335498

SHMT1 (untagged) - Human serine hydroxymethyltransferase 1 (soluble) (SHMT1), transcript variant 3


  "NM_001281786" in other vectors (1)

Reconstitution Protocol

USD 350.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SHMT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SHMT1
Synonyms CSHMT; SHMT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281786, the custom clone sequence may differ by one or more nucleotides


ATGGGCCTGGACCTTCCGGATGGGGGCCACCTGACCCATGGGTTCATGACAGACAAGAAGAAAATCTCTG
CCACGTCCATCTTCTTTGAATCTATGCCCTACAAGGTGAACCCAGATACTGGCTACATCAACTATGACCA
GCTGGAGGAGAACGCACGCCTCTTCCACCCGAAGCTGATCATCGCAGGAACCAGCTGCTACTCCCGAAAC
CTGGAATATGCCCGGCTACGGAAGATTGCAGATGAGAACGGGGCGTATCTCATGGCGGACATGGCTCACA
TCAGCGGGCTGGTGGCGGCTGGCGTGGTGCCCTCCCCATTTGAACACTGCCATGTGGTGACCACCACCAC
TCACAAGACCCTGCGAGGCTGCCGAGCTGGCATGATCTTCTACAGGAAAGGAGTGAAAAGTGTGGATCCC
AAGACTGGCAAAGAGATTCTGTACAACCTGGAGTCTCTTATCAATTCTGCTGTGTTCCCTGGCCTGCAGG
GAGGTCCCCACAACCACGCCATTGCTGGGGTTGCTGTGGCACTGAAGCAAGCTATGACTCTGGAATTTAA
AGTTTATCAACACCAGGTGGTGGCCAACTGCAGGGCTCTGTCTGAGGCCCTGACGGAGCTGGGCTACAAA
ATAGTCACAGGTGGTTCTGACAACCATTTGATCCTTGTGGATCTCCGTTCCAAAGGCACAGATGGTGGAA
GGGCTGAGAAGGTGCTAGAAGCCTGTTCTATTGCCTGCAACAAGAACACCTGTCCAGGTGACAGAAGCGC
TCTGCGGCCCAGTGGACTGCGGCTGGGGACCCCAGCACTGACGTCCCGTGGACTTTTGGAAAAAGACTTC
CAAAAAGTAGCCCACTTTATTCACAGAGGGATAGAGCTGACCCTGCAGATCCAGAGCGACACTGGTGTCA
GAGCCACCCTGAAAGAGTTCAAGGAGAGACTGGCAGGGGATAAGTACCAGGCGGCCGTGCAGGCTCTCCG
GGAGGAGGTTGAGAGCTTCGCCTCTCTCTTCCCTCTGCCTGGCCTGCCTGACTTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001281786
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001281786.1, NP_001268715.1
RefSeq Size 2437 bp
RefSeq ORF 1038 bp
Locus ID 6470
Cytogenetics 17p11.2
Protein Pathways Cyanoamino acid metabolism, Glycine, serine and threonine metabolism, Metabolic pathways, Methane metabolism, One carbon pool by folate
Gene Summary 'This gene encodes the cytosolic form of serine hydroxymethyltransferase, a pyridoxal phosphate-containing enzyme that catalyzes the reversible conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. This reaction provides one-carbon units for synthesis of methionine, thymidylate, and purines in the cytoplasm. This gene is located within the Smith-Magenis syndrome region on chromosome 17. A pseudogene of this gene is located on the short arm of chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]'
Transcript Variant: This variant (3) uses an alternate 5' exon structure, and thus differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (3) with a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.