Thrombopoietin (THPO) (NM_001290022) Human Untagged Clone
CAT#: SC335525
THPO (untagged) - Human thrombopoietin (THPO), transcript variant 6
"NM_001290022" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | THPO |
Synonyms | MGDF; MKCSF; ML; MPLLG; THCYT1; TPO |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001290022, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGACTGAATTGCTCCTCGTGGTCATGCTTCTCCTAACTGCAAGGCTAACGCTGTCCAGCCCGG CTCCTCCTGCTTGTGACCTCCGAGTCCTCAGTAAACTGCTTCGTGACTCCCATGTCCTTCACAGCAGACT GAGCCAGTGCCCAGAGGTTCACCCTTTGCCTACACCTGTCCTGCTGCCTGCTGTGGACTTTAGCTTGGGA GAATGGAAAACCCAGATGGAGGAGACCAAGGCACAGGACATTCTGGGAGCAGTGACCCTTCTGCTGGAGG GAGTGATGGCAGCACGGGGACAACTGGGACCCACTTGCCTCTCATCCCTCCTGGGGCAGCTTTCTGGACA GGTCCGTCTCCTCCTTGGGGCCCTGCAGAGCCTCCTTGGAACCCAGGGCAGGACCACAGCTCACAAGGAT CCCAATGCCATCTTCCTGAGCTTCCAACACCTGCTCCGAGGAAAGGTGCGTTTCCTGATGCTTGTAGGAG GGTCCACCCTCTGCGTCAGGCGGGCCCCACCCACCACAGCTGTCCCCAGCAGAACCTCTCTAGTCCTCAC ACTGAACGAGCTCCCAAACAGGACTTCTGGATTGTTGGAGACAAACTTCACTGCCTCAGCCAGAACTACT GGCTCTGGGCTTCTGAAGTGGCAGCAGGGATTCAGAGCCAAGATTCCTGGTCTGCTGAACCAAACCTCCA GGTCCCTGGACCAAATCCCCGGATACCTGAACAGGATACACGAACTCTTGAATGGAACTCGTGGACTCTT TCCTGGACCCTCACGCAGGACCCTAGGAGCCCCGGACATTTCCTCAGGAACATCAGACACAGGCTCCCTG CCACCCAACCTCCAGCCTGGATATTCTCCTTCCCCAACCCATCCTCCTACTGGACAGTATACGCTCTTCC CTCTTCCACCCACCTTGCCCACCCCTGTGGTCCAGCTCCACCCCCTGCTTCCTGACCCTTCTGCTCCAAC GCCCACCCCTACCAGCCCTCTTCTAAACACATCCTACACCCACTCCCAGAATCTGTCTCAGGAAGGGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290022 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290022.1, NP_001276951.1 |
RefSeq Size | 2178 bp |
RefSeq ORF | 1050 bp |
Locus ID | 7066 |
Cytogenetics | 3q27.1 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Hematopoietic cell lineage |
Gene Summary | 'Megakaryocytopoiesis is the cellular development process that leads to platelet production. The main functional protein encoded by this gene is a humoral growth factor that is necessary for megakaryocyte proliferation and maturation, as well as for thrombopoiesis. This protein is the ligand for MLP/C_MPL, the product of myeloproliferative leukemia virus oncogene. Mutations in this gene are the cause of thrombocythemia 1. Alternative promoter usage and differential splicing result in multiple transcript variants differing in the 5' UTR and/or coding region. Multiple AUG codons upstream of the main open reading frame (ORF) have been identified, and these upstream AUGs inhibit translation of the main ORF at different extent. [provided by RefSeq, Feb 2014]' Transcript Variant: This variant (6) represents use of the upstream promoter and comprises seven exons. This variant is longer at the 5' end and has an alternate in-frame splice site in the 3' coding region, compared to variant 1. This variant includes two main in-frame AUG sites, but translation initiated from the upstream AUG codon for this variant is not reported in literature. The isoform (2) represented in this RefSeq is derived from the downstream AUG start codon; it is identical to the isoform encoded by variant 2 and lacks an internal segment, as compared to isoform 1. This variant was reported in PMID: 7822271. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237631 | THPO (myc-DDK-tagged) - Human thrombopoietin (THPO), transcript variant 6 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review