ZNF180 (NM_001288760) Human Untagged Clone
CAT#: SC335529
ZNF180 (untagged) - Human zinc finger protein 180 (ZNF180), transcript variant 5
"NM_001288760" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ZNF180 |
Synonyms | HHZ168 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001288760, the custom clone sequence may differ by one or more nucleotides
ATGAGAAATAATTCTGAAGAGAAACCTTTTGAATGTAATCAGTGTGGGAAATCCTTCAGCTGGAGCTCGC ATCTTGTTGCACATCAGAGAACTCACACAGGGGAGAAACCTTATGAATGTAGTGAATGTGGAAAATCCTT CAGCCGGAGCTCGCACCTTGTTTCCCATCAGAGAACTCATACTGGAGAGAAACCTTACAGGTGTAATCAA TGTGGGAAATCCTTTAGCCAGAGTTATGTCCTTGTTGTGCATCAAAGAACTCATACTGGGGAGAAGCCTT ATGAATGCAATCAGTGTGGAAAGTCATTCAGGCAGAGCTATAAACTTATTGCACATCAAAGAACACATAC CGGAGAGAAGCCCTATGAATGTAATCAATGTGGGAAATCATTTATCCAGAGCTATAAACTTATTGCACAT CAAAGAATTCATACTGGGGAAAAACCCTATGAATGCAATCAGTGTGGGAAATCCTTTAGTCAAAGTTATA AACTTGTTGCTCATCAGAGAACTCACACAGGAGAAAAACCCTTTGAATGTAATCAGTGTGGGAAATCCTT CAGCTGGAGCTCTCAGCTTGTTGCACATCAAAGAACTCACACTGGAGAGAAACCGTATGAATGTAGTGAA TGTGGAAAATCTTTTAACCGCAGTTCTCACCTTGTTATGCATCAGAGAATTCACACTGGGGAAAAACCGT ATGAATGTAATCAGTGTGGGAAATCCTTCAGCCAGAGTTATGTTCTTGTTGTACATCAGAGAACTCATAC TGGAGAAAAGCCCTATGAATGCAGTCAATGTGGGAAGTCCTTCAGACAGAGTTCATGCCTTACTCAACAT CAGAGAACTCATACTGGAGAGAAACCATTTGAATGTAATCAGTGTGGAAAAACATTTAGCTTGAGTGCTC GACTTATTGTGCATCAAAGAACTCATACTGGAGAGAAACCCTTTACATGTATTCAGTGTGGAAAAGCTTT CATTAATAGCTATAAACTTATTAGGCATCAGGCAACTCATACTGAAGAGAAACTCTATGAATGTAACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001288760 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001288760.2, NP_001275689.1 |
RefSeq Size | 4509 bp |
RefSeq ORF | 1050 bp |
Locus ID | 7733 |
Cytogenetics | 19q13.31 |
Protein Families | Transcription Factors |
Gene Summary | 'Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]' Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, contains alternate exons, and initiates translation at a downstream start codon, compared to variant 1. This results in an isoform (5) with a shorter N-terminus, compared to isoform 1. Variants 5, 6, and 7 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237635 | ZNF180 (myc-DDK-tagged) - Human zinc finger protein 180 (ZNF180), transcript variant 5 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review