ZNF180 (NM_001288762) Human Untagged Clone

CAT#: SC335531

ZNF180 (untagged) - Human zinc finger protein 180 (ZNF180), transcript variant 7


  "NM_001288762" in other vectors (1)

Reconstitution Protocol

USD 360.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZNF180"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZNF180
Synonyms HHZ168
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288762, the custom clone sequence may differ by one or more nucleotides


ATGAGAAATAATTCTGAAGAGAAACCTTTTGAATGTAATCAGTGTGGGAAATCCTTCAGCTGGAGCTCGC
ATCTTGTTGCACATCAGAGAACTCACACAGGGGAGAAACCTTATGAATGTAGTGAATGTGGAAAATCCTT
CAGCCGGAGCTCGCACCTTGTTTCCCATCAGAGAACTCATACTGGAGAGAAACCTTACAGGTGTAATCAA
TGTGGGAAATCCTTTAGCCAGAGTTATGTCCTTGTTGTGCATCAAAGAACTCATACTGGGGAGAAGCCTT
ATGAATGCAATCAGTGTGGAAAGTCATTCAGGCAGAGCTATAAACTTATTGCACATCAAAGAACACATAC
CGGAGAGAAGCCCTATGAATGTAATCAATGTGGGAAATCATTTATCCAGAGCTATAAACTTATTGCACAT
CAAAGAATTCATACTGGGGAAAAACCCTATGAATGCAATCAGTGTGGGAAATCCTTTAGTCAAAGTTATA
AACTTGTTGCTCATCAGAGAACTCACACAGGAGAAAAACCCTTTGAATGTAATCAGTGTGGGAAATCCTT
CAGCTGGAGCTCTCAGCTTGTTGCACATCAAAGAACTCACACTGGAGAGAAACCGTATGAATGTAGTGAA
TGTGGAAAATCTTTTAACCGCAGTTCTCACCTTGTTATGCATCAGAGAATTCACACTGGGGAAAAACCGT
ATGAATGTAATCAGTGTGGGAAATCCTTCAGCCAGAGTTATGTTCTTGTTGTACATCAGAGAACTCATAC
TGGAGAAAAGCCCTATGAATGCAGTCAATGTGGGAAGTCCTTCAGACAGAGTTCATGCCTTACTCAACAT
CAGAGAACTCATACTGGAGAGAAACCATTTGAATGTAATCAGTGTGGAAAAACATTTAGCTTGAGTGCTC
GACTTATTGTGCATCAAAGAACTCATACTGGAGAGAAACCCTTTACATGTATTCAGTGTGGAAAAGCTTT
CATTAATAGCTATAAACTTATTAGGCATCAGGCAACTCATACTGAAGAGAAACTCTATGAATGTAACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001288762
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288762.2, NP_001275691.1
RefSeq Size 4214 bp
RefSeq ORF 1050 bp
Locus ID 7733
Cytogenetics 19q13.31
Protein Families Transcription Factors
Gene Summary 'Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]'
Transcript Variant: This variant (7) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. This results in an isoform (5) with a shorter N-terminus, compared to isoform 1. Variants 5, 6, and 7 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.