ZKSCAN1 (NM_001287055) Human Untagged Clone

CAT#: SC335532

ZKSCAN1 (untagged) - Human zinc finger with KRAB and SCAN domains 1 (ZKSCAN1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZKSCAN1
• Synonyms: KOX18; PHZ-37; ZNF36; ZNF139; ZSCAN33
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001287055, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCATCTGCACTATTCACAGCGGATTCCCAGGCAATGGTGAAGATCGAGGACATGGCTGTGTCCCTCA
  TTCTGGAGGAATGGGGATGTCAGAATCTGGCTCGGAGGAATCTCAGTAGGGACAACAGGCAGGAGAATTA
  TGGGAGCGCATTTCCCCAGGGTGGTGAAAACAGGAATGAGAACGAGGAGTCAACCTCAAAGGCTGAAACC
  TCGGAAGATTCAGCATCACGCGGGGAGACAACAGGAAGATCCCAGAAAGAGTTTGGAGAGAAACGTGACC
  AGGAGGGCAAAACAGGAGAAAGACAGCAGAAAAACCCTGAGGAGAAAACCAGGAAAGAGAAAAGAGATTC
  AGGGCCAGCTATAGGAAAGGACAAAAAAACCATCACAGGAGAGAGAGGTCCAAGGGAGAAGGGGAAAGGA
  TTGGGAAGAAGCTTCAGTCTGAGCTCCAACTTCACCACCCCTGAAGAAGTTCCCACGGGAACAAAGTCTC
  ACAGATGTGATGAATGTGGTAAATGCTTCACGAGAAGTTCAAGCCTTATCCGCCATAAAATAATCCACAC
  TGGAGAAAAGCCCTATGAATGTAGTGAGTGTGGGAAAGCCTTCAGTCTTAACTCCAACCTTGTCCTGCAT
  CAGAGGATCCACACAGGAGAGAAACCTCATGAATGTAACGAGTGTGGCAAGGCCTTCAGCCACAGTTCCA
  ATCTCATCCTCCATCAGCGCATCCACTCTGGAGAGAAACCTTATGAATGTAATGAGTGCGGGAAGGCCTT
  CAGCCAGAGCTCGGACCTCACCAAGCATCAGAGAATTCACACGGGGGAGAAACCCTATGAATGTAGTGAA
  TGTGGAAAAGCTTTCAACCGAAACTCATACCTGATTTTGCATCGGAGAATTCACACTCGAGAAAAGCCCT
  ACAAGTGCACTAAGTGTGGCAAGGCCTTCACCCGCAGCTCCACCCTCACTCTGCATCACAGAATCCATGC
  CAGAGAGAGAGCCTCTGAGTACAGCCCAGCCTCCCTTGATGCATTTGGCGCGTTCCTGAAAAGTTGTGTG
  TAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001287055
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287055.1, NP_001273984.1
• RefSeq Size: 8776 bp
• RefSeq ORF: 1053 bp
• Locus ID: 7586
• Cytogenetics: 7q22.1
• Protein Families: Transcription Factors
• Gene Summary: 'This gene encodes a member of the Kruppel C2H2-type zinc-finger family of proteins. This encoded protein may function as a transcription factor that regulates the expression of GABA type-A receptors in the brain. Transcripts from this gene have been shown to form stable and abundant circular RNAs. Elevated expression of this gene has been observed in gastric cancer and the encoded protein may stimulate migration and invasion of human gastric cancer cells. [provided by RefSeq, Oct 2016]'
  Transcript Variant: This variant (3) differs in its 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.