Prostatic Acid Phosphatase (ACPP) (NM_001292037) Human Untagged Clone

CAT#: SC335563

ACPP (untagged) - Human acid phosphatase, prostate (ACPP), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ACPP
• Synonyms: 5'-NT; ACP-3; ACP3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001292037, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGAGCTGCACCCCTCCTCCTGGCCAGGGCAGCAAGCCTTAGCCTTGGCTTCTTGTTTCTGCTTTTTT
  TCTGGCTAGACCGAAGTGTACTAGCCAAGGAGTTGAAGTTTGTGACTTTGGTGTTTCGGCATGGAGACCG
  AAGTCCCATTGACACCTTTCCCACTGACCCCATAAAGGAATCCTCATGGCCACAAGGATTTGGCCAACTC
  ACCCAGCTGGGCATGGAGCAGCATTATGAACTTGGAGAGTATATAAGAAAGAGATATAGAAAATTCTTGA
  ATGAGTCCTATAAACATGAACAGGTTTATATTCGAAGCACAGACGTTGACCGGACTTTGATGAGTGCTAT
  GACAAACCTGGCAGCCCTGTTTCCCCCAGAAGGTGTCAGCATCTGGAATCCTATCCTACTCTGGCAGCCC
  ATCCCGGTGCACACAGTTCCTCTTTCTGAAGATCAGGATTTTATAGCTACCTTGGGAAAACTTTCAGGAT
  TACATGGCCAGGACCTTTTTGGAATTTGGAGTAAAGTCTACGACCCTTTATATTGTGAGAGTGTTCACAA
  TTTCACTTTACCCTCCTGGGCCACTGAGGACACCATGACTAAGTTGAGAGAATTGTCAGAATTGTCCCTC
  CTGTCCCTCTATGGAATTCACAAGCAGAAAGAGAAATCTAGGCTCCAAGGGGGTGTCCTGGTCAATGAAA
  TCCTCAATCACATGAAGAGAGCAACTCAGATACCAAGCTACAAAAAACTCATCATGTATTCTGCGCATGA
  CACTACTGTGAGTGGCCTACAGATGGCGCTAGATGTTTACAACGGACTCCTTCCTCCCTATGCTTCTTGC
  CACTTGACGGAATTGTACTTTGAGAAGGGGGAGTACTTTGTGGAGATGTACTATCGGAATGAGACGCAGC
  ACGAGCCGTATCCCCTCATGCTACCTGGCTGCAGCCCCAGCTGTCCTCTGGAGAGGTTTGCTGAGCTGGT
  TGGCCCTGTGATCCCTCAAGACTGGTCCACGGAGTGTATGACCACAAACAGCCATCAAGGTACTGAAGAC
  AGTACAGATTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001292037
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001292037.1, NP_001278966.1
• RefSeq Size: 3120 bp
• RefSeq ORF: 1062 bp
• Locus ID: 55
• Cytogenetics: 3q22.1
• Protein Families: Druggable Genome, Phosphatase, Transmembrane
• Protein Pathways: Riboflavin metabolism
• Gene Summary: 'This gene encodes an enzyme that catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is synthesized under androgen regulation and is secreted by the epithelial cells of the prostate gland. An alternatively spliced transcript variant encoding a longer isoform has been found for this gene. This isoform contains a transmembrane domain and is localized in the plasma membrane-endosomal-lysosomal pathway. [provided by RefSeq, Sep 2008]'
  Transcript Variant: This variant (3) lacks an alternate exon in the coding region compared to variant 1. The resulting protein (isoform 3) is shorter but has the same N- and C-termini compared to isoform PAP.