Thrombopoietin (THPO) (NM_001290028) Human Untagged Clone

CAT#: SC335569

THPO (untagged) - Human thrombopoietin (THPO), transcript variant 9


  "NM_001290028" in other vectors (1)

Reconstitution Protocol

USD 360.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "THPO"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol THPO
Synonyms MGDF; MKCSF; ML; MPLLG; THCYT1; TPO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290028, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTGACTGAATTGCTCCTCGTGGTCATGCTTCTCCTAACTGCAAGGCTAACGCTGTCCAGCCCGG
CTCCTCCTGCTTGTGACCTCCGAGTCCTCAGTAAACTGCTTCGTGACTCCCATGTCCTTCACAGCAGACT
GAGCCAGTGCCCAGAGGTTCACCCTTTGCCTACACCTGTCCTGCTGCCTGCTGTGGACTTTAGCTTGGGA
GAATGGAAAACCCAGATGGAGGAGACCAAGGCACAGGACATTCTGGGAGCAGTGACCCTTCTGCTGGAGG
GAGTGATGGCAGCACGGGGACAACTGGGACCCACTTGCCTCTCATCCCTCCTGGGGCAGCTTTCTGGACA
GGTCCGTCTCCTCCTTGGGGCCCTGCAGAGCCTCCTTGGAACCCAGCTTCCTCCACAGGGCAGGACCACA
GCTCACAAGGATCCCAATGCCATCTTCCTGAGCTTCCAACACCTGCTCCGAGGAAAGGTGCGTTTCCTGA
TGCTTGTAGGAGGGTCCACCCTCTGCGTCAGGCGGGCCCCACCCACCACAGCTGTCCCCAGCAGAACCTC
TCTAGTCCTCACACTGAACGAGCTCCCAAACAGGACTTCTGGATTGTTGGAGACAAACTTCACTGCCTCA
GCCAGAACTACTGGCTCTGGGCTTCTGAAGTGGCAGCAGGGATTCAGAGCCAAGATTCCTGGTCTGCTGA
ACCAAACCTCCAGGTCCCTGGACCAAATCCCCGGATACCTGAACAGGATACACGAACTCTTGAATGGAAC
TCGTGGACTCTTTCCTGGACCCTCACGCAGGACCCTAGGAGCCCCGGACATTTCCTCAGGAACATCAGAC
ACAGGCTCCCTGCCACCCAACCTCCAGCCTGGATATTCTCCTTCCCCAACCCATCCTCCTACTGGACAGT
ATACGCTCTTCCCTCTTCCACCCACCTTGCCCACCCCTGTGGTCCAGCTCCACCCCCTGCTTCCTGACCC
TTCTGCTCCAACGCCCACCCCTACCAGCCCTCTTCTAAACACATCCTACACCCACTCCCAGAATCTGTCT
CAGGAAGGGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001290028
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290028.1, NP_001276957.1
RefSeq Size 1887 bp
RefSeq ORF 1062 bp
Locus ID 7066
Cytogenetics 3q27.1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Hematopoietic cell lineage
Gene Summary 'Megakaryocytopoiesis is the cellular development process that leads to platelet production. The main functional protein encoded by this gene is a humoral growth factor that is necessary for megakaryocyte proliferation and maturation, as well as for thrombopoiesis. This protein is the ligand for MLP/C_MPL, the product of myeloproliferative leukemia virus oncogene. Mutations in this gene are the cause of thrombocythemia 1. Alternative promoter usage and differential splicing result in multiple transcript variants differing in the 5' UTR and/or coding region. Multiple AUG codons upstream of the main open reading frame (ORF) have been identified, and these upstream AUGs inhibit translation of the main ORF at different extent. [provided by RefSeq, Feb 2014]'
Transcript Variant: This variant (9) represents use of the upstream promoter, but lacks an internal exon, compared to other transcripts with the same upstream promoter usage. This variant has an alternate 5' UTR exon and encodes the same isoform (1), compared to variant 1. This variant was reported in PMID: 9834204. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.