SERPINB4 (NM_175041) Human Untagged Clone
CAT#: SC335670
SERPINB4 (untagged) - Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4), transcript variant 2
"NM_175041" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SERPINB4 |
Synonyms | LEUPIN; PI11; SCCA-2; SCCA1; SCCA2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_175041, the custom clone sequence may differ by one or more nucleotides
ATGAATTCACTCAGTGAAGCCAACACCAAGTTCATGTTCGATCTGTTCCAACAGTTCAGAAAATCAAAAG AGAACAACATCTTCTATTCCCCTATCAGCATCACATCAGCATTAGGGATGGTCCTCTTAGGAGCCAAAGA CAACACTGCACAACAAATTAGCAAGGTTCTTCACTTTGATCAAGTCACAGAGAACACCACAGAAAAAGCT GCAACATATCATGTTGATAGGTCAGGAAATGTTCATCACCAGTTTCAAAAGCTTCTGACTGAATTCAACA AATCCACTGATGCATATGAGCTGAAGATCGCCAACAAGCTCTTCGGAGAAAAGACGTATCAATTTTTACA GGAATATTTAGATGCCATCAAGAAATTTTACCAGACCAGTGTGGAATCTACTGATTTTGCAAATGCTCCA GAAGAAAGTCGAAAGAAGATTAACTCCTGGGTGGAAAGTCAAACGAATGAAAAAATTAAAAACCTATTTC CTGATGGGACTATTGGCAATGATACGACACTGGTTCTTGTGAACGCAATCTATTTCAAAGGGCAGTGGGA GAATAAATTTAAAAAAGAAAACACTAAAGAGGAAAAATTTTGGCCAAACAAGGATGTACAGGCCAAGGTC CTGGAAATACCATACAAAGGCAAAGATCTAAGCATGATTGTGCTGCTGCCAAATGAAATCGATGGTCTGC AGAAGCTTGAAGAGAAACTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCAGAATATGAGAGAGAC ATGTGTCGATTTACACTTACCTCGGTTCAAAATGGAAGAGAGCTATGACCTCAAGGACACGTTGAGAACC ATGGGAATGGTGAATATCTTCAATGGGGATGCAGACCTCTCAGGCATGACCTGGAGCCACGGTCTCTCAG TATCTAAAGTCCTACACAAGGCCTTTGTGGAGGTCACTGAGGAGGGAGTGGAAGCTGCAGCTGCCACCGC TGTAGTAGTAGTCGAATTATCATCTCCTTCAACTAATGAAGAGTTCTGTTGTAATCACCCTTTCCTATTC TTCATAAGGCAAAATAAGACCAACAGCATCCTCTTCTATGGCAGATTCTCATCCCCATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_175041 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_175041.1, NP_778206.1 |
RefSeq Size | 1724 bp |
RefSeq ORF | 1110 bp |
Locus ID | 6318 |
Cytogenetics | 18q21.33 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | 'The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein is highly expressed in many tumor cells and can inactivate granzyme M, an enzyme that kills tumor cells. This protein, along with serpin B3, can be processed into smaller fragments that aggregate to form an autoantigen in psoriasis, probably by causing chronic inflammation. [provided by RefSeq, Jan 2017]' Transcript Variant: This variant (2) uses an alternate in-frame splice site, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237776 | SERPINB4 (myc-DDK-tagged) - Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review