IRF6 (NM_001206696) Human Untagged Clone

CAT#: SC335692

IRF6 (untagged) - Human interferon regulatory factor 6 (IRF6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IRF6
• Synonyms: LPS; OFC6; PIT; PPS; PPS1; VWS; VWS1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206696, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTATGATGGCACCAAGGAGGTGCCCATGAACCCAGTGAAGATATATCAAGTGTGTGACATCCCTCAGC
  CCCAGGGCTCGATCATTAACCCAGGATCCACAGGGTCTGCTCCCTGGGATGAGAAGGATAATGATGTGGA
  TGAAGAAGATGAGGAAGATGAGCTGGATCAGTCGCAGCACCATGTTCCCATCCAGGACACCTTCCCCTTC
  CTGAACATCAATGGTTCTCCCATGGCGCCAGCCAGTGTGGGCAATTGCAGTGTGGGCAACTGCAGCCCGG
  AGGCAGTGTGGCCCAAAACTGAACCCCTGGAGATGGAAGTACCCCAGGCACCTATACAGCCCTTCTATAG
  CTCTCCAGAACTGTGGATCAGCTCTCTCCCAATGACTGACCTGGACATCAAGTTTCAGTACCGTGGGAAG
  GAGTACGGGCAGACCATGACCGTGAGCAACCCTCAGGGCTGCCGACTCTTCTATGGGGACCTGGGTCCCA
  TGCCTGACCAGGAGGAGCTCTTTGGTCCCGTCAGCCTGGAGCAGGTCAAATTCCCAGGTCCTGAGCATAT
  TACCAATGAGAAGCAGAAGCTGTTCACTAGCAAGCTGCTGGACGTCATGGACAGAGGACTGATCCTGGAG
  GTCAGCGGTCATGCCATTTATGCCATCAGGCTGTGCCAGTGCAAGGTGTACTGGTCTGGGCCATGTGCCC
  CATCACTTGTTGCTCCCAACCTGATTGAGAGACAAAAGAAGGTCAAGCTATTTTGTCTGGAAACATTCCT
  TAGCGATCTCATTGCCCACCAGAAAGGACAGATAGAGAAGCAGCCACCGTTTGAGATCTACTTATGCTTT
  GGGGAAGAATGGCCAGATGGGAAACCATTGGAAAGGAAACTCATCTTGGTTCAGGTCATTCCAGTAGTGG
  CTCGGATGATCTACGAGATGTTTTCTGGTGATTTCACACGATCCTTTGATAGTGGCAGTGTCCGCCTGCA
  GATCTCAACCCCAGACATCAAGGATAACATCGTTGCTCAGCTGAAGCAGCTGTACCGCATCCTTCAAACC
  CAGGAGAGCTGGCAGCCCATGCAGCCCACCCCCAGCATGCAACTGCCCCCTGCCCTGCCTCCCCAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206696
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206696.1, NP_001193625.1
• RefSeq Size: 4256 bp
• RefSeq ORF: 1119 bp
• Locus ID: 3664
• Cytogenetics: 1q32.2
• Protein Families: ES Cell Differentiation/IPS, Transcription Factors
• Gene Summary: 'This gene encodes a member of the interferon regulatory transcription factor (IRF) family. Family members share a highly-conserved N-terminal helix-turn-helix DNA-binding domain and a less conserved C-terminal protein-binding domain. The encoded protein may be a transcriptional activator. Mutations in this gene can cause van der Woude syndrome and popliteal pterygium syndrome. Mutations in this gene are also associated with non-syndromic orofacial cleft type 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2011]'
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.