Carboxypeptidase B2 (CPB2) (NM_001278541) Human Untagged Clone

CAT#: SC335790

CPB2 (untagged) - Human carboxypeptidase B2 (plasma) (CPB2), transcript variant 2


  "NM_001278541" in other vectors (1)

Reconstitution Protocol

USD 390.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CPB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CPB2
Synonyms CPU; PCPB; TAFI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278541, the custom clone sequence may differ by one or more nucleotides


ATGAAGCTTTGCAGCCTTGCAGTCCTTGTACCCATTGTTCTCTTCTGTGAGCAGCATGTCTTCGCGTTTC
AGAGTGGCCAAGTTCTAGCTGCTCTTCCTAGAACCTCTAGGCAAGTTCAAGTTCTACAGAATCTTACTAC
AACATATGAGATTGTTCTCTGGCAGCCGGTAACAGCTGACCTTATTGTGAAGAAAAAACAAGTCCATTTT
TTTGTAAATGCATCTGATGTCGACAATGTGAAAGCCCATTTAAATGTGAGCGGAATTCCATGCAGTGTCT
TGCTGGCAGATGTGGAAGATCTTATTCAACAGCAGATTTCCAACGACACAGTCAGCCCCCGAGCCTCCGC
ATCGTACTATGAACAGTATCACTCACTAAATGAAATCTATTCTTGGATAGAATTTATAACTGAGAGGCAT
CCTGATATGCTTACAAAAATCCACATTGGATCCTCATTTGAGAAGTACCCACTCTATGTTTTAAAGGTTT
CTGGAAAAGAACAAGCAGCCAAAAATGCCATATGGATTGACTGTGGAATCCATGCCAGAGAATGGATCTC
TCCTGCTTTCTGCTTGTGGTTCATAGGCCATAATCGAATGTGGAGAAAGAACCGTTCTTTCTATGCGAAC
AATCATTGCATCGGAACAGACCTGAATAGGAACTTTGCTTCCAAACACTGGTGTGAGGAAGGTGCATCCA
GTTCCTCATGCTCGGAAACCTACTGTGGACTTTATCCTGAGTCAGAACCAGAAGTGAAGGCAGTGGCTAG
TTTCTTGAGAAGAAATATCAACCAGATTAAAGCATACATCAGCATGCATTCATACTCCCAGCATATAGTG
TTTCCATATTCCTATACACGAAGTAAAAGCAAAGACCATGAGGAACTGTCTCTAGTAGCCAGTGAAGCAG
TTCGTGCTATTGAGAAAATTAGTAAAAATACCAGGTATACACATGGCCATGGCTCAGAAACCTTATACCT
AGCTCCTGGAGGTGGGGACGATTGGATCTATGATTTGGGCATCAAATATTCGTTTACAATTGAACTTCGA
GATACGGGCACATACGGATTCTTGCTGCCGGAGCGTTACATCAAACCCACCTGTAGAGAAGCTTTTGCCG
CTGTCTCTAAAATAGCTTGGCATGTCATTAGGAATGTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278541
ORF Size 1161 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001278541.1, NP_001265470.1
RefSeq Size 1655
RefSeq ORF 1161
Locus ID 1361
Protein Families Druggable Genome, Protease, Secreted Protein
Protein Pathways Complement and coagulation cascades
Gene Summary Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.