Cytochrome P450 3A5 (CYP3A5) (NM_001291829) Human Untagged Clone
CAT#: SC335807
CYP3A5 (untagged) - Human cytochrome P450, family 3, subfamily A, polypeptide 5 (CYP3A5), transcript variant 4
"NM_001291829" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CYP3A5 |
Synonyms | CP35; CYPIIIA5; P450PCN3; PCN3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291829, the custom clone sequence may differ by one or more nucleotides
ATGAAAAGTGCCATCTCTTTAGCTGAGGATGAAGAATGGAAGAGAATACGGTCATTGCTGTCTCCAACCT TCACCAGCGGAAAACTCAAGGAGATGTTCCCCATCATTGCCCAGTATGGAGATGTATTGGTGAGAAACTT GAGGCGGGAAGCAGAGAAAGGCAAGCCTGTCACCTTGAAAGACATCTTTGGGGCCTACAGCATGGATGTG ATTACTGGCACATCATTTGGAGTGAACATCGACTCTCTCAACAATCCACAAGACCCCTTTGTGGAGAGCA CTAAGAAGTTCCTAAAATTTGGTTTCTTAGATCCATTATTTCTCTCAATAATACTCTTTCCATTCCTTAC CCCAGTTTTTGAAGCATTAAATGTCTCTCTGTTTCCAAAAGATACCATAAATTTTTTAAGTAAATCTGTA AACAGAATGAAGAAAAGTCGCCTCAACGACAAACAAAAGCACCGACTAGATTTCCTTCAGCTGATGATTG ACTCCCAGAATTCGAAAGAAACTGAGTCCCACAAAGCTCTGTCTGATCTGGAGCTCGCAGCCCAGTCAAT AATCTTCATTTTTGCTGGCTATGAAACCACCAGCAGTGTTCTTTCCTTCACTTTATATGAACTGGCCACT CACCCTGATGTCCAGCAGAAACTGCAAAAGGAGATTGATGCAGTTTTGCCCAATAAGGCACCACCTACCT ATGATGCCGTGGTACAGATGGAGTACCTTGACATGGTGGTGAATGAAACACTCAGATTATTCCCAGTTGC TATTAGACTTGAGAGGACTTGCAAGAAAGATGTTGAAATCAATGGGGTATTCATTCCCAAAGGGTCAATG GTGGTGATTCCAACTTATGCTCTTCACCATGACCCAAAGTACTGGACAGAGCCTGAGGAGTTCCGCCCTG AAAGGTTCAGTAAGAAGAAGGACAGCATAGATCCTTACATATACACACCCTTTGGAACTGGACCCAGAAA CTGCATTGGCATGAGGTTTGCTCTCATGAACATGAAACTTGCTCTAATCAGAGTCCTTCAGAACTTCTCC TTCAAACCTTGTAAAGAAACACAGATCCCCTTGAAATTAGACACGCAAGGACTTCTTCAACCAGAAAAAC CCATTGTTCTAAAGGTGGATTCAAGAGATGGAACCCTAAGTGGAGAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291829 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291829.1, NP_001278758.1 |
RefSeq Size | 2255 bp |
RefSeq ORF | 1170 bp |
Locus ID | 1577 |
Cytogenetics | 7q22.1 |
Protein Families | Druggable Genome, P450, Transmembrane |
Protein Pathways | Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Linoleic acid metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism |
Gene Summary | 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein metabolizes drugs as well as the steroid hormones testosterone and progesterone. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Two pseudogenes of this gene have been identified within this cluster on chromosome 7. Expression of this gene is widely variable among populations, and a single nucleotide polymorphism that affects transcript splicing has been associated with susceptibility to hypertensions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]' Transcript Variant: This variant (4) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237913 | CYP3A5 (myc-DDK-tagged) - Human cytochrome P450, family 3, subfamily A, polypeptide 5 (CYP3A5), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review