DARS (NM_001293312) Human Untagged Clone

CAT#: SC335884

DARS (untagged) - Human aspartyl-tRNA synthetase (DARS), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DARS
• Synonyms: aspRS; HBSL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001293312, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTTAAATTTGCTGCCAACATCAACAAAGAGAGCATTGTGGATGTAGAAGGTGTTGTGAGAAAAGTGA
  ATCAGAAAATTGGAAGCTGTACACAGCAAGACGTTGAGTTACATGTTCAGAAGATTTATGTGATCAGTTT
  GGCTGAACCCCGTCTGCCCCTGCAGCTGGATGATGCTGTTCGGCCTGAGGCAGAAGGAGAAGAGGAAGGA
  AGAGCTACTGTTAACCAGGATACAAGATTAGACAACAGAGTCATTGATCTTAGGACATCAACTAGTCAGG
  CAGTCTTCCGTCTCCAGTCTGGCATCTGCCATCTCTTCCGAGAAACTTTAATTAACAAAGGTTTTGTGGA
  AATCCAAACTCCTAAAATTATTTCAGCTGCCAGTGAAGGAGGAGCCAATGTTTTTACTGTGTCATATTTT
  AAAAATAATGCATACCTGGCTCAGTCCCCACAGCTATATAAGCAAATGTGCATTTGTGCTGATTTTGAGA
  AGGTTTTCTCTATTGGACCAGTATTCAGAGCGGAAGACTCTAATACCCATAGACATCTAACTGAGTTTGT
  TGGTTTGGACATTGAAATGGCTTTTAATTACCATTACCACGAAGTTATGGAAGAAATTGCTGACACCATG
  GTACAAATATTCAAAGGACTTCAAGAAAGGTTTCAGACTGAAATTCAAACAGTGAATAAACAGTTCCCAT
  GTGAGCCATTCAAATTTTTGGAGCCAACTCTAAGACTAGAATATTGTGAAGCATTGGCTATGCTTAGGGA
  AGCTGGAGTCGAAATGGGAGATGAAGACGATCTGAGCACACCAAATGAAAAGCTGTTGGGTCATTTGGTA
  AAGGAAAAGTATGATACAGATTTTTATATTCTTGATAAATATCCATTGGCTGTAAGACCTTTCTATACCA
  TGCCTGACCCAAGAAATCCCAAACAGTCCAACTCTTACGATATGTTCATGAGAGGAGAAGAAATATTGTC
  AGGAGCTCAAAGAATACATGATCCTCAACTGCTAACAGAGAGAGCTTTACATCATGGAATTGATTTGGAG
  AAAATTAAGGCTTACATTGATTCCTTCCGCTTTGGAGCCCCTCCTCATGCTGGTGGAGGCATTGGATTGG
  AACGAGTTACTATGCTGTTTCTGGGATTGCATAATGTTCGTCAGACCTCCATGTTCCCTCGTGATCCCAA
  ACGACTCACTCCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293312
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293312.1, NP_001280241.1
• RefSeq Size: 3113 bp
• RefSeq ORF: 1206 bp
• Locus ID: 1615
• Cytogenetics: 2q21.3
• Protein Pathways: Aminoacyl-tRNA biosynthesis
• Gene Summary: 'This gene encodes a member of a multienzyme complex that functions in mediating the attachment of amino acids to their cognate tRNAs. The encoded protein ligates L-aspartate to tRNA(Asp). Mutations in this gene have been found in patients showing hypomyelination with brainstem and spinal cord involvement and leg spasticity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]'
  Transcript Variant: This variant (2) lacks an exon in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.