DARS (NM_001293312) Human Untagged Clone

CAT#: SC335884

DARS (untagged) - Human aspartyl-tRNA synthetase (DARS), transcript variant 2


  "NM_001293312" in other vectors (1)

Reconstitution Protocol

USD 400.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DARS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DARS
Synonyms aspRS; HBSL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001293312, the custom clone sequence may differ by one or more nucleotides


ATGGTTAAATTTGCTGCCAACATCAACAAAGAGAGCATTGTGGATGTAGAAGGTGTTGTGAGAAAAGTGA
ATCAGAAAATTGGAAGCTGTACACAGCAAGACGTTGAGTTACATGTTCAGAAGATTTATGTGATCAGTTT
GGCTGAACCCCGTCTGCCCCTGCAGCTGGATGATGCTGTTCGGCCTGAGGCAGAAGGAGAAGAGGAAGGA
AGAGCTACTGTTAACCAGGATACAAGATTAGACAACAGAGTCATTGATCTTAGGACATCAACTAGTCAGG
CAGTCTTCCGTCTCCAGTCTGGCATCTGCCATCTCTTCCGAGAAACTTTAATTAACAAAGGTTTTGTGGA
AATCCAAACTCCTAAAATTATTTCAGCTGCCAGTGAAGGAGGAGCCAATGTTTTTACTGTGTCATATTTT
AAAAATAATGCATACCTGGCTCAGTCCCCACAGCTATATAAGCAAATGTGCATTTGTGCTGATTTTGAGA
AGGTTTTCTCTATTGGACCAGTATTCAGAGCGGAAGACTCTAATACCCATAGACATCTAACTGAGTTTGT
TGGTTTGGACATTGAAATGGCTTTTAATTACCATTACCACGAAGTTATGGAAGAAATTGCTGACACCATG
GTACAAATATTCAAAGGACTTCAAGAAAGGTTTCAGACTGAAATTCAAACAGTGAATAAACAGTTCCCAT
GTGAGCCATTCAAATTTTTGGAGCCAACTCTAAGACTAGAATATTGTGAAGCATTGGCTATGCTTAGGGA
AGCTGGAGTCGAAATGGGAGATGAAGACGATCTGAGCACACCAAATGAAAAGCTGTTGGGTCATTTGGTA
AAGGAAAAGTATGATACAGATTTTTATATTCTTGATAAATATCCATTGGCTGTAAGACCTTTCTATACCA
TGCCTGACCCAAGAAATCCCAAACAGTCCAACTCTTACGATATGTTCATGAGAGGAGAAGAAATATTGTC
AGGAGCTCAAAGAATACATGATCCTCAACTGCTAACAGAGAGAGCTTTACATCATGGAATTGATTTGGAG
AAAATTAAGGCTTACATTGATTCCTTCCGCTTTGGAGCCCCTCCTCATGCTGGTGGAGGCATTGGATTGG
AACGAGTTACTATGCTGTTTCTGGGATTGCATAATGTTCGTCAGACCTCCATGTTCCCTCGTGATCCCAA
ACGACTCACTCCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001293312
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293312.1, NP_001280241.1
RefSeq Size 3113 bp
RefSeq ORF 1206 bp
Locus ID 1615
Cytogenetics 2q21.3
Protein Pathways Aminoacyl-tRNA biosynthesis
Gene Summary 'This gene encodes a member of a multienzyme complex that functions in mediating the attachment of amino acids to their cognate tRNAs. The encoded protein ligates L-aspartate to tRNA(Asp). Mutations in this gene have been found in patients showing hypomyelination with brainstem and spinal cord involvement and leg spasticity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]'
Transcript Variant: This variant (2) lacks an exon in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.