EOMES (NM_001278183) Human Untagged Clone

CAT#: SC335942

EOMES (untagged) - Human eomesodermin (EOMES), transcript variant 3


  "NM_001278183" in other vectors (1)

Reconstitution Protocol

USD 410.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "EOMES"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EOMES
Synonyms TBR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278183, the custom clone sequence may differ by one or more nucleotides


ATGTTTCCTTTCTTGAGCTTCAACATAAACGGACTCAATCCCACTGCCCACTACAATGTGTTCGTAGAGG
TGGTGCTGGCGGACCCCAACCACTGGCGCTTCCAGGGGGGCAAATGGGTGACCTGTGGCAAAGCCGACAA
TAACATGCAGGGCAACAAAATGTATGTTCACCCAGAGTCTCCTAATACTGGTTCCCACTGGATGAGACAG
GAGATTTCATTCGGGAAATTAAAACTCACCAATAACAAAGGCGCAAATAACAACAACACCCAGATGATAG
TCTTACAATCCTTACACAAATACCAACCCCGACTGCATATTGTTGAAGTTACAGAGGATGGCGTGGAGGA
CTTGAATGAGCCCTCAAAGACCCAGACTTTTACCTTCTCAGAAACGCAATTCATTGCAGTGACTGCCTAC
CAAAACACCGATATTACTCAACTAAAGATTGATCATAACCCCTTTGCAAAAGGCTTCAGAGACAACTATG
ATTCCATGTACACCGCTTCAGAAAATGACAGGTTAACTCCATCTCCCACGGATTCTCCTAGATCCCATCA
GATTGTCCCTGGAGGTCGGTACGGCGTTCAATCCTTCTTCCCGGAGCCCTTTGTCAACACTTTACCTCAA
GCCCGCTATTATAATGGCGAGAGAACCGTGCCACAGACCAACGGCCTCCTTTCACCCCAACAGAGCGAAG
AGGTGGCCAACCCTCCCCAGCGGTGGCTTGTCACGCCTGTCCAGCAACCTGGGACCAACAAACTAGACAT
CAGTTCCTATGAATCTGAATATACTTCTAGCACATTGCTCCCATATGGCATTAAATCCTTGCCCCTTCAG
ACATCCCATGCCCTGGGGTATTACCCAGACCCAACCTTTCCTGCAATGGCAGGGTGGGGAGGTCGAGGTT
CTTACCAGAGGAAGATGGCAGCTGGACTACCATGGACCTCCAGAACAAGCCCCACTGTGTTCTCTGAAGA
TCAGCTCTCCAAGGAGAAAGTGAAAGAGGAAATTGGCTCTTCTTGGATAGAGACACCCCCTTCCATCAAA
TCTCTAGATTCCAATGATTCAGGAGTATACACCAGTGCTTGTAAGCGAAGGCGGCTGTCTCCTAGCAACT
CCAGTAATGAAAATTCACCCTCCATAAAGTGTGAGGACATTAATGCTGAAGAGTATAGTAAAGACACCTC
AAAAGGCATGGGAGGGTATTATGCTTTTTACACAACTCCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278183
ORF Size 1233 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_001278183.1, NP_001265112.1
RefSeq Size 2658
RefSeq ORF 1233
Locus ID 8320
Protein Families Embryonic stem cells, ES Cell Differentiation/IPS, Transcription Factors
Gene Summary This gene belongs to the TBR1 (T-box brain protein 1) sub-family of T-box genes that share the common DNA-binding T-box domain. The encoded protein is a transcription factor which is crucial for embryonic development of mesoderm and the central nervous system in vertebrates. The protein may also be necessary for the differentiation of effector CD8+ T cells which are involved in defense against viral infections. A similar gene disrupted in mice is shown to be essential during trophoblast development and gastrulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (3) differs in the 5' UTR, 5' coding region and initiates translation at a downstream AUG, compared to variant 1. It encodes isoform 3 which has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.