alpha Tubulin (TUBA4A) (NM_001278552) Human Untagged Clone

CAT#: SC336095

TUBA4A (untagged) - Human tubulin, alpha 4a (TUBA4A), transcript variant 2


  "NM_001278552" in other vectors (1)

Reconstitution Protocol

USD 430.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TUBA4A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TUBA4A
Synonyms ALS22; H2-ALPHA; TUBA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278552, the custom clone sequence may differ by one or more nucleotides


ATGGGCAATGCCTGCTGGGAGCTCTATTGCTTGGAACATGGGATTCAGCCTGATGGGCAGATGCCCAGTG
ACAAGACCATTGGTGGAGGGGACGACTCCTTCACCACCTTCTTCTGTGAAACTGGTGCTGGAAAACACGT
ACCCCGGGCAGTTTTTGTGGATCTGGAGCCTACGGTCATTGATGAGATCCGAAATGGCCCATACCGACAG
CTCTTCCACCCAGAGCAGCTCATCACTGGGAAAGAGGATGCTGCCAACAACTATGCCCGTGGTCACTATA
CCATTGGCAAGGAGATCATTGACCCAGTGCTGGATCGGATCCGCAAGCTGTCTGACCAGTGCACAGGACT
TCAGGGCTTCCTGGTGTTCCACAGCTTTGGTGGGGGCACTGGCTCTGGCTTCACCTCACTCCTGATGGAG
CGGCTCTCTGTTGACTATGGCAAGAAATCCAAGCTGGAATTCTCCATCTACCCAGCCCCCCAGGTGTCTA
CAGCCGTGGTCGAGCCCTACAACTCTATCCTGACCACCCACACCACCCTGGAGCACTCAGACTGTGCCTT
CATGGTGGACAACGAAGCAATCTATGACATCTGCCGCCGCAACCTAGACATCGAGCGCCCAACCTACACC
AACCTCAATCGCCTCATTAGCCAAATTGTCTCCTCCATCACAGCTTCTCTGCGCTTTGACGGGGCCCTCA
ATGTGGACCTGACAGAGTTCCAGACCAACCTGGTGCCCTACCCTCGCATCCACTTCCCCCTGGCCACCTA
TGCACCAGTCATCTCTGCAGAAAAGGCATACCACGAGCAGCTGTCGGTGGCAGAGATCACCAATGCCTGC
TTTGAGCCTGCCAACCAGATGGTAAAGTGTGATCCCCGGCACGGCAAGTACATGGCCTGCTGCCTGCTGT
ACCGTGGAGATGTGGTGCCCAAGGATGTCAACGCTGCCATTGCCGCCATCAAGACCAAGCGCAGCATTCA
GTTTGTGGACTGGTGCCCCACAGGCTTCAAGGTTGGTATCAACTACCAGCCTCCCACTGTGGTGCCTGGG
GGTGACCTGGCCAAGGTGCAGCGTGCCGTGTGCATGCTGAGCAACACGACCGCCATCGCCGAGGCCTGGG
CCCGCCTGGACCACAAGTTCGACCTGATGTATGCCAAGAGGGCGTTTGTGCACTGGTATGTGGGTGAGGG
CATGGAGGAGGGTGAGTTCTCCGAGGCCCGTGAGGATATGGCTGCCCTGGAGAAGGATTATGAGGAGGTG
GGCATCGACTCCTATGAGGACGAGGATGAGGGAGAAGAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001278552
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278552.1, NP_001265481.1
RefSeq Size 2499 bp
RefSeq ORF 1302 bp
Locus ID 7277
Cytogenetics 2q35
Protein Families Druggable Genome
Protein Pathways Gap junction, Pathogenic Escherichia coli infection
Gene Summary 'Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]'
Transcript Variant: This variant (2) contains an alternate 5' exon, which results in translation initiation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.