C2 (NM_001282457) Human Untagged Clone

CAT#: SC336508

C2 (untagged) - Human complement component 2 (C2), transcript variant 4


  "NM_001282457" in other vectors (1)

Reconstitution Protocol

USD 520.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C2
Synonyms ARMD14; CO2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282457, the custom clone sequence may differ by one or more nucleotides


ATGGGGACAAGGTCCGCTATCGCTGCTCCTCGAATCTTGTGCTCACGGGGTCTTCGGAGCGGGAGTGCCA
GGGCAACGGGGTCTGGAGTGGAACGGAGCCCATCTGCCGCCATCTTCAGCTTTGAGATCAATGTGAGCGT
TGCCATTATCACCTTTGCCTCAGAGCCCAAAGTCCTCATGTCTGTCCTGAACGACAACTCCCGGGATATG
ACTGAGGTGATCAGCAGCCTGGAAAATGCCAACTATAAAGATCATGAAAATGGAACTGGGACTAACACCT
ATGCGGCCTTAAACAGTGTCTATCTCATGATGAACAACCAAATGCGACTCCTCGGCATGGAAACGATGGC
CTGGCAGGAAATCCGACATGCCATCATCCTTCTGACAGATGGAAAGTCCAATATGGGTGGCTCTCCCAAG
ACAGCTGTTGACCATATCAGAGAGATCCTGAACATCAACCAGAAGAGGAATGACTATCTGGACATCTATG
CCATCGGGGTGGGCAAGCTGGATGTGGACTGGAGAGAACTGAATGAGCTAGGGTCCAAGAAGGATGGTGA
GAGGCATGCCTTCATTCTGCAGGACACAAAGGCTCTGCACCAGGTCTTTGAACATATGCTGGATGTCTCC
AAGCTCACAGACACCATCTGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGAGGACACCCT
GGCATGTCACTATTAAGCCCAAGAGCCAAGAGACCTGCCGGGGGGCCCTCATCTCCGACCAATGGGTCCT
GACAGCAGCTCATTGCTTCCGCGATGGCAACGACCACTCCCTGTGGAGGGTCAATGTGGGAGACCCCAAA
TCCCAGTGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGATCTCCCCAGGGTTTGATGTCTTTGCCAAAA
AGAACCAGGGAATCCTGGAGTTCTATGGTGATGACATAGCTCTGCTGAAGCTGGCCCAGAAAGTAAAGAT
GTCCACCCATGCCAGGCCCATCTGCCTTCCCTGCACGATGGAGGCCAATCTGGCTCTGCGGAGACCTCAA
GGCAGCACCTGTAGGGACCATGAGAATGAACTGCTGAACAAACAGAGTGTTCCTGCTCATTTTGTCGCCT
TGAATGGGAGCAAACTGAACATTAACCTTAAGATGGGAGTGGAGTGGACAAGCTGTGCCGAGGTTGTCTC
CCAAGAAAAAACCATGTTCCCCAACTTGACAGATGTCAGGGAGGTGGTGACAGACCAGTTCCTATGCAGT
GGGACCCAGGAGGATGAGAGTCCCTGCAAGGGAGAATCTGGGGGAGCAGTTTTCCTTGAGCGGAGATTCA
GGTTTTTTCAGGTGGGTCTGGTGAGCTGGGGTCTTTACAACCCCTGCCTTGGCTCTGCTGACAAAAACTC
CCGCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCACGAGACTTTCACATCAATCTCTTCCGCATGCAG
CCCTGGCTGAGGCAGCACCTGGGGGATGTCCTGAATTTTTTACCCCTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001282457
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282457.1, NP_001269386.1
RefSeq Size 2069 bp
RefSeq ORF 1521 bp
Locus ID 717
Cytogenetics 6p21.33
Protein Families Druggable Genome, Protease, Secreted Protein
Protein Pathways Complement and coagulation cascades, Systemic lupus erythematosus
Gene Summary 'Component C2 is a serum glycoprotein that functions as part of the classical pathway of the complement system. Activated C1 cleaves C2 into C2a and C2b. The serine proteinase C2a then combines with complement factor 4b to create the C3 or C5 convertase. Deficiency of C2 has been reported to associated with certain autoimmune diseases and SNPs in this gene have been associated with altered susceptibility to age-related macular degeneration. This gene localizes within the class III region of the MHC on the short arm of chromosome 6. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described in publications but their full-length sequence has not been determined.[provided by RefSeq, Mar 2009]'
Transcript Variant: This variant (4) represents use of an alternate promoter and has multiple differences in the coding region compared to variant 1. The resulting protein (isoform 4) has a distinct N-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.