Human MYH10 activation kit by CRISPRa

CAT#: GA103070

MYH10 CRISPRa kit - CRISPR gene activation of human myosin heavy chain 10

  See Other Versions


Find the corresponding CRISPRi Inhibitor Kit

USD 1,290.00

2 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-MYH10 Antibody
    • 100 ul

USD 475.00


qSTAR qPCR primer pairs against Homo sapiens gene MYH10
    • 200 reactions

USD 120.00

Other products for "MYH10"

Specifications

Product Data
Format 3gRNAs, 1 scramble ctrl and 1 enhancer vector
Symbol MYH10
Locus ID 4628
Kit Components

GA103070G1, MYH10 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGCCAAACCCTGTGCGCAT

GA103070G2, MYH10 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGAGTCCTGACGTCACCCC

GA103070G3, MYH10 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCTGCGACTCACCTGCAGT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer The kit is designed based on the best knowledge of CRISPa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_001256012, NM_001256095, NM_005964
Synonyms NMMHC-IIB; NMMHCB
Summary 'This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.