Sequencing Primer, XL39-R

CAT#: GE100137

Reverse primer to sequence targets cloned in expression vectors.


USD 66.00

In Stock*

Size
    • 1 nmol

Product Images

Specifications

Product Data
Sequence 5' ATTAGGACAAGGCTGGTGGG 3'
Applicable Vectors PS100001, PS100002, PS100004, PS100005, PS100006, PS100007, PS100008, PS100009, PS100011, PS100012, PS100013, PS100014, PS100016, PS100017, PS100018, PS100019, PS100020, PS100022, PS100024, PS100025, PS100026, PS100033, PS100035, PS100047, PS100048, PS100049, PS100051, PS100052, PS100055, PS100056, PS100057, PS100058, PS100061, PS100066, PS100067, PS100089, PS100111
Components 1 vial of lyophilized squencing primer (1 nmol, sufficient for 100 sequencing reactions)
Quality Control The primer has been tested to generate satisfactory squencing data on ABI 3730.
Storage Store at -20°C.
Stability The lyophilized and suspended primer is stable for one year from date of shipping when stored at -20°C

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.