SINHCAF Human qPCR Primer Pair (NM_001135812)

CAT#: HP234281

qSTAR qPCR primer pairs against Homo sapiens gene FAM60A



SensiMix SYBR Master Mix

USD 120.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (1)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 mL (500 rxns/20ul reaction)

USD 305.00

Other products for "SINHCAF"

Specifications

Product Data
Gene ID 58516
Forward Sequence GACTCGTTCAGGAGACATCTGC
Reverse Sequence AGTCTTTAGACTGGGTCCAGCC
Accession No NM_001135812
Synonyms C12orf14; FAM60A; L4; TERA
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

Early changes in the hypothalamic region in prodromal Huntington disease revealed by MRI analysis
Soneson, Fontes, Zhou et al
Neurobiol Dis (2010) 40 (3), 531-43 DOI: 10.1016/j.nbd.2010.07.013
Evaluation of optimized b-value sampling schemas for diffusion kurtosis imaging with an application to stroke patient data
Yan, Zhou, Ying et al
Comput Med Imaging Graph (2013) 37 (4), 272-80 DOI: 10.1016/j.compmedimag.2013.04.007
Preparing for selective inhibition within frontostriatal loops
Smittenaar, Guitart-Masip, Lutti et al
J Neurosci (2013) 33 (46), 18087-97 DOI: 10.1523/JNEUROSCI.2167-13.2013
Showing 1-5 of 27 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.