SARS-CoV-2 (COVID-19) qPCR Primer Pair N protein
CAT#: HP234775
qSTAR qPCR primer pairs against SARS-CoV-2 (COVID-19) Nucleocapsid Phosphoprotein (N protein) gene
SensiMix SYBR Master Mix
USD 120.00
5 Days*
Size
Other products for "N Protein"
Specifications
Product Data | |
Gene ID | 43740575 |
Forward Sequence | aagctggacttccctatggtg |
Reverse Sequence | cgattgcagcattgttagcagg |
Accession No | NC_045512.2 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT |
Storage | The primer mix is stable for one year from date of shipping. Store at -20°C. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.