SARS-CoV-2 (COVID-19) qPCR Primer Pair N protein
CAT#: HP234775
qSTAR qPCR primer pairs against SARS-CoV-2 (COVID-19) Nucleocapsid Phosphoprotein (N protein) gene
SensiMix SYBR Master Mix
USD 120.00
5 Days*
Size
Frequently bought together (1)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
USD 305.00
Other products for "N Protein"
Specifications
Product Data | |
Gene ID | 43740575 |
Forward Sequence | aagctggacttccctatggtg |
Reverse Sequence | cgattgcagcattgttagcagg |
Accession No | NC_045512.2 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT |
Storage | The primer mix is stable for one year from date of shipping. Store at -20°C. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.