SARS-CoV-2 (COVID-19) qPCR Primer Pair S protein
CAT#: HP234776
qSTAR qPCR primer pairs against SARS-CoV-2 (COVID-19) surface glycoprotein (S protein) gene
SensiMix SYBR Master Mix
USD 120.00
5 Days*
Size
Product Images
Frequently bought together (1)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
USD 305.00
Specifications
| Product Data | |
| Gene ID | 43740568 |
| Forward Sequence | caactgaaatctatcaggccg |
| Reverse Sequence | accaacaccattagtgggttg |
| Accession No | NC_045512.2 |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT |
| Storage | The primer mix is stable for one year from date of shipping. Store at -20°C. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China