Ano6 Mouse qPCR Primer Pair (NM_175344)

CAT#: MP217398

qSTAR qPCR primer pairs against Mus musculus gene Ano6



SensiMix SYBR Master Mix

USD 120.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (1)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 mL (500 rxns/20ul reaction)

USD 305.00

Other products for "Ano6"

Specifications

Product Data
Gene ID 105722
Forward Sequence CGCATCCCATTTACCACCTGTG
Reverse Sequence CGATGAACACGGACAGCCTGTA
Accession No NM_175344
Synonyms 2900059G15Rik; AA407480; AW554778; F730003B03Rik; Tmem16f
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.