Mir466c Mouse MicroRNA Expression Plasmid (MI0005505)

CAT#: SC401065

Expression plasmid for mouse microRNA Mir466c


USD 396.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (1)
DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 135.00

Other products for "Mir466c"

Specifications

Product Data
Species Mouse
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Precursor:
GUAUAUGUGUUGAUGUGUGUGUGCAUGUACAUAUGUGAAUAUGAUAUACAUAUACAUACACGCACACAUAAGACACAUAUGAGC
Mature Sequence:
GAUGUGUGUGUGCAUGUACAUA
>MI0005505 CCCTATGTATGTGCCCGTGTGCGT
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Product Components
  • 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
  • 1 x 100 pmol VP1.5 primer
  • 1 x 100 pmol XL39 primer
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
Reference Data
RefSeq MI0005505

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.