pCas-Guide-ROSA26

CAT#: GE100050

ROSA26 safe harbor gRNA vector, validated ROSA26 targeting sequence cloned in pCas-Guide vector

SDS

Reconstitution Protocol

USD 470.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Function Rosa26 gRNA
Features
  • Validated all-in-one CRISPR vector targeting Mouse ROSA26 locus
  • ROSA26 target sequence: TTATTGCTTGTGATCCGCCT
  • Contains CMV-driven Cas9 and U6-driven ROSA26 gRNA expression
  • Targeted transgene insertion via CRISPR when cotransfect with pROSA26-Puro-DNR (after transgene is cloned)
  • Download vector sequence

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.