MED25 (NM_030973) Human 3' UTR Clone

CAT#: SC200040

3`UTR clone of mediator complex subunit 25 (MED25) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MED25
• Synonyms: ACID1; ARC92; BVSYS; CMT2B2; P78; PTOV2; TCBAP0758
• ACCN: NM_030973
• Insert Size: 44
• Sequence Data:
  Insert Sequence

  >SC200040 3'UTR clone of NM_030973
  The sequence shown below is from the reference sequence of NM_030973. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGACGACATCCTCATGGATCTCATCTGAATCCCCAACACCCAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_030973.3
• Summary: This gene encodes a component of the transcriptional coactivator complex termed the Mediator complex. This complex is required for transcription of most RNA polymerase II-dependent genes. The encoded protein plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. [provided by RefSeq, Apr 2010]
• Locus ID: 81857