RNA Polymerase II p14.5 (POLR2I) (NM_006233) Human 3' UTR Clone
CAT#: SC200107
3`UTR clone of polymerase (RNA) II (DNA directed) polypeptide I 14.5kDa (POLR2I) for miRNA target validation
Product Images
![](https://cdn.origene.com/img/defaults-img.jpg)
Other products for "POLR2I"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | POLR2I |
Synonyms | hRPB14.5; RPB9 |
ACCN | NM_006233 |
Insert Size | 62 bp |
Sequence Data |
>SC200107 3'UTR clone of NM_006233
The sequence shown below is from the reference sequence of NM_006233. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC ACCGCTGGACCGAGTGACCTCCTCTCTCCCCCGAGTGTAATAAACACCAGATTCCATGCGTG ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_006233.4 |
Summary | 'This gene encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit, in combination with two other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. The product of this gene has two zinc finger motifs with conserved cysteines and the subunit does possess zinc binding activity. [provided by RefSeq, Jul 2008]' |
Locus ID | 5438 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.