Galectin 1 (LGALS1) (NM_002305) Human 3' UTR Clone

CAT#: SC200373

3`UTR clone of lectin galactoside-binding soluble 1 (LGALS1) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LGALS1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol LGALS1
Synonyms GAL1; GBP
ACCN NM_002305
Insert Size 76 bp
Sequence Data
>SC200373 3'UTR clone of NM_002305
The sequence shown below is from the reference sequence of NM_002305. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGAAATCAGCCAGCCCATGGCCCCCAATAAAG
GCAGCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002305.3
Summary 'The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]'
Locus ID 3956

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.