Properdin (CFP) (NM_002621) Human 3' UTR Clone

CAT#: SC201135

3`UTR clone of complement factor properdin (CFP) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CFP
• Synonyms: BFD; PFC; PFD; PROPERDIN
• ACCN: NM_002621
• Insert Size: 72 bp
• Sequence Data:
  Insert Sequence

  >SC201135 3'UTR clone of NM_002621
  The sequence shown below is from the reference sequence of NM_002621. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAAGACCCTGAGGAAGAGGAACTCTAACACTTCTCTCCTCCACTCTGAGCCCCCTGACCTTCCAAACCT
  CA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002621.2
• Summary: 'This gene encodes a plasma glycoprotein that positively regulates the alternative complement pathway of the innate immune system. This protein binds to many microbial surfaces and apoptotic cells and stabilizes the C3- and C5-convertase enzyme complexes in a feedback loop that ultimately leads to formation of the membrane attack complex and lysis of the target cell. Mutations in this gene result in two forms of properdin deficiency, which results in high susceptibility to meningococcal infections. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Feb 2009]'
• Locus ID: 5199