TLR9 (NM_017442) Human 3' UTR Clone

CAT#: SC201161

3`UTR clone of toll-like receptor 9 (TLR9) transcript variant A for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TLR9
• Synonyms: CD289
• ACCN: NM_017442
• Insert Size: 152
• Sequence Data:
  Insert Sequence

  >SC201161 3'UTR clone of NM_017442
  The sequence shown below is from the reference sequence of NM_017442. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGAACTTCTGCCAGGGACCCACGGCCGAATAGCCGTGAGCCGGAATCCTGCACGGTGCCACCTCCACAC
  TCACCTCACCTCTGCCTGCCTGGTCTGACCCTCCCCTGCTCGCCTCCCTCACCCCACACCTGACACAGAG
  CAGGCACTCAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_017442.2
• Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Aug 2017]
• Locus ID: 54106