Dermokine (DMKN) (NM_001126057) Human 3' UTR Clone

CAT#: SC201336

3`UTR clone of dermokine (DMKN) transcript variant 5 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DMKN"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DMKN
Synonyms UNQ729; ZD52F10
ACCN NM_001126057
Insert Size 140
Sequence Data
>SC201336 3'UTR clone of NM_001126057
The sequence shown below is from the reference sequence of NM_001126057. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGATGCCATAAACAAGGACCAGAGAAGCTCTCGCATCCCGTGACCTCCAGACAAGGAGCCACCAGATTGG
ATGGGAGCCCCCACACTCCCTCCTTAAAACACCACCCTCTCATCACTAATCTCAGCCCTTGCCCTTGAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001126057.1
Summary This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Locus ID 93099

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.