PTGR1 (NM_001146108) Human 3' UTR Clone

CAT#: SC201488

3`UTR clone of prostaglandin reductase 1 (PTGR1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PTGR1
• Synonyms: LTB4DH; PGR1; ZADH3
• ACCN: NM_001146108
• Insert Size: 148
• Sequence Data:
  Insert Sequence

  >SC201488 3'UTR clone of NM_001146108
  The sequence shown below is from the reference sequence of NM_001146108. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAGACAATAGTGAAAGCATGAAAAAGAGGACACATGGAATCTGGAGGCCATTTAGATGATTAGTTAAT
  TTGTTTTTCACCATTTAGCAAAAATGTATACTACCTTAAATGTCTTAAGAAATAGTACTCATAATGAGTT
  TGAGCTAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001146108.1
• Summary: This gene encodes an enzyme that is involved in the inactivation of the chemotactic factor, leukotriene B4. The encoded protein specifically catalyzes the NADP+ dependent conversion of leukotriene B4 to 12-oxo-leukotriene B4. A pseudogene of this gene is found on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
• Locus ID: 22949