Calcyon (CALY) (NM_015722) Human 3' UTR Clone

CAT#: SC201743

3`UTR clone of calcyon neuron-specific vesicular protein (CALY) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CALY
• Synonyms: DRD1IP; NSG3
• ACCN: NM_015722
• Insert Size: 161
• Sequence Data:
  Insert Sequence

  >SC201743 3'UTR clone of NM_015722
  The sequence shown below is from the reference sequence of NM_015722. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGCCCGCGCAGTGACGTCTCCAGCCCCGCAGCCCGGCCCGGGCGTCCTCCGCCAGCTCCTGTGACCAGC
  GCGTCTCCCGATGCTCTCCGCCGTGTTCGTGTCCCCAGGCGCCCTCGCTGCAGCCCCGCCCCCGTGGGTC
  TCTGACTCTGTCGCTTTTCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_015722.3
• Summary: The protein encoded by this gene is a type II single transmembrane protein. It is required for maximal stimulated calcium release after stimulation of purinergic or muscarinic but not beta-adrenergic receptors. The encoded protein interacts with D1 dopamine receptor and may interact with other DA receptor subtypes and/or GPCRs. [provided by RefSeq, Jul 2008]
• Locus ID: 50632