PLRG1 (NM_002669) Human 3' UTR Clone

CAT#: SC202047

3`UTR clone of pleiotropic regulator 1 (PRL1 homolog Arabidopsis) (PLRG1) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLRG1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PLRG1
Synonyms Cwc1; PRL1; PRP46; PRPF46; TANGO4
ACCN NM_002669
Insert Size 191 bp
Sequence Data
>SC202047 3'UTR clone of NM_002669
The sequence shown below is from the reference sequence of NM_002669. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCAGTCAGCTGGAAACCAGAAATTATCAAGAGAAAGAGATTTTAATGAATGTGGAATTTTTTCTCTCTCT
TTTTTTTTCTTTTTAATTAAAAAAAAAAAAGCTTGGCGTTCATGAGGATATCCAGTCATTTTGTGCTCTG
GCTGGGAATATAAAGGAGAAATTCACTTGCTTCAATCATTGCTGCTTCATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002669.2
Summary 'This gene encodes a core component of the cell division cycle 5-like (CDC5L) complex. The CDC5L complex is part of the spliceosome and is required for pre-mRNA splicing. The encoded protein plays a critical role in alternative splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]'
Locus ID 5356

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.