PLRG1 (NM_002669) Human 3' UTR Clone

CAT#: SC202047

3`UTR clone of pleiotropic regulator 1 (PRL1 homolog Arabidopsis) (PLRG1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLRG1
• Synonyms: Cwc1; PRL1; PRP46; PRPF46; TANGO4
• ACCN: NM_002669
• Insert Size: 191 bp
• Sequence Data:
  Insert Sequence

  >SC202047 3'UTR clone of NM_002669
  The sequence shown below is from the reference sequence of NM_002669. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGTCAGCTGGAAACCAGAAATTATCAAGAGAAAGAGATTTTAATGAATGTGGAATTTTTTCTCTCTCT
  TTTTTTTTCTTTTTAATTAAAAAAAAAAAAGCTTGGCGTTCATGAGGATATCCAGTCATTTTGTGCTCTG
  GCTGGGAATATAAAGGAGAAATTCACTTGCTTCAATCATTGCTGCTTCATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002669.2
• Summary: 'This gene encodes a core component of the cell division cycle 5-like (CDC5L) complex. The CDC5L complex is part of the spliceosome and is required for pre-mRNA splicing. The encoded protein plays a critical role in alternative splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]'
• Locus ID: 5356