PECI (ECI2) (NM_001166010) Human 3' UTR Clone

CAT#: SC202185

3`UTR clone of peroxisomal D3D2-enoyl-CoA isomerase (PECI) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ECI2
• Synonyms: ACBD2; dJ1013A10.3; DRS-1; DRS1; HCA88; PECI
• ACCN: NM_001166010
• Insert Size: 199
• Sequence Data:
  Insert Sequence

  >SC202185 3'UTR clone of NM_001166010
  The sequence shown below is from the reference sequence of NM_001166010. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCACAAATGCTGTGGTGAACTTCTTATCCAGAAAATCAAAACTGTGATGACCACTACAGCAGAGTAAAGC
  ATGTCCAAGGAAGGATGTGCTGTTACCTCTGATTTCCAGTACTGGAACTAAATAAGCTTCATTGTGCCTT
  TTGTAGTGCTAGAATATCAATTACAATGATGATATTTCACTACAGCTCTGATGAATAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001166010.1
• Summary: This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
• Locus ID: 10455