YY1AP1 (NM_139118) Human 3' UTR Clone

CAT#: SC202287

3`UTR clone of YY1 associated protein 1 (YY1AP1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: YY1AP1
• Synonyms: HCCA1; HCCA2; YAP; YY1AP
• ACCN: NM_139118
• Insert Size: 216
• Sequence Data:
  Insert Sequence

  >SC202287 3'UTR clone of NM_139118
  The sequence shown below is from the reference sequence of NM_139118. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGAAGATGCTACAGAGGAAATCAGTGGATTTCTTTGAGCTAGGAGAATAAGAGTCTGGAGACTGGGAG
  CCTTCACTTCGGCCTCCGATTGGTGGCGCATAGGGTGTAACCAATAGGAAACCCCTAAAGGGTACTTAAA
  CCCCAGATTTTGCAACTGGGGCTCTTGAGCAGCTTGCTTTAGCCTGCTCCCACTCTGTGGAATATACTTT
  TGCTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_139118.1
• Summary: The encoded gene product presumably interacts with YY1 protein; however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 55249