CPNE1 (NM_152926) Human 3' UTR Clone

CAT#: SC202483

3`UTR clone of copine I (CPNE1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CPNE1
• Synonyms: COPN1; CPN1
• ACCN: NM_152926
• Insert Size: 213
• Sequence Data:
  Insert Sequence

  >SC202483 3'UTR clone of NM_152926
  The sequence shown below is from the reference sequence of NM_152926. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTTCCACCCTCAGCCAAGGATCCTGCACAGGCCCCCCAGGCCTAGGTTCCCTTGGAGGCTGTGGCAAGT
  CCTCAATCCTGTGTCCCAGAGGTCCCTCTGGGCCACAACCCAACCCTTCTCACTCTCCTCAGTGCTAGCA
  CTTTGTATTTTTTGATACTTTTATACTTGTTTCTGCTTTTGCTGCTCTTGATCCCACCTTTGCTCCTGAC
  AAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_152926.1
• Summary: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene encodes a calcium-dependent protein that also contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. However, the encoded protein does not contain a predicted signal sequence or transmembrane domains. This protein has a broad tissue distribution and it may function in membrane trafficking. This gene and the gene for RNA binding motif protein 12 overlap at map location 20q11.21. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Aug 2008]
• Locus ID: 8904