PSMD1 (NM_002807) Human 3' UTR Clone

CAT#: SC202815

3`UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 1 (PSMD1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSMD1
• Synonyms: P112; Rpn2; S1
• ACCN: NM_002807
• Insert Size: 281 bp
• Sequence Data:
  Insert Sequence

  >SC202815 3'UTR clone of NM_002807
  The sequence shown below is from the reference sequence of NM_002807. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AACAAGAGCCAGAACCCCCAGAACCATTTGAGTATATTGATGATTAAGGGCCAGAGGATCTCACTTGCTT
  ATCTGAAGAAGATTGTCCAGGCTCATATTGGGAATGCTTATGAGGAAATTCATGCCGAGACCTGCTATTC
  AATGCATGTATCGTTGCCTCTGCACTGACCTGAAGAACCCTGTCTCCAAGTCTTTGGTTGAAGAGAAGAT
  ATATGACTGTTGAGTGTGCTCTTTCACAGAACTTGGTTTTCAAATAAATATAAGATCTCCAGATGGACAA
  G
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002807.2
• Summary: 'The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes the largest non-ATPase subunit of the 19S regulator lid, which is responsible for substrate recognition and binding. There is evidence that this proteasome and its subunits interact with viral proteins, including those of coronaviruses. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Aug 2020]'
• Locus ID: 5707