ABCF2 (NM_005692) Human 3' UTR Clone

CAT#: SC203033

3`UTR clone of ATP-binding cassette sub-family F (GCN20) member 2 (ABCF2) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABCF2
• Synonyms: ABC28; EST133090; HUSSY-18; HUSSY18
• ACCN: NM_005692
• Insert Size: 237
• Sequence Data:
  Insert Sequence

  >SC203033 3'UTR clone of NM_005692
  The sequence shown below is from the reference sequence of NM_005692. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGACATTGGCATCTCTGCCAAGGCCATGAGCATCATGAACTCGTTTGTAAACGACGTGTTTGAGCAGC
  TGGCGTGTGAGGCTGCCCGGCTGGCCCAGTACTCGGGCCGGACCACCCTGACATCCCGAGAAGTCCAGAC
  GGCTGTGCGTCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCTGTGTCTGAGGGCACCAAGGCTGTCACC
  AAGTACACCAGCTCCAAGTGACCCAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005692.3
• Summary: This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding casette proteins transport various molecules across extra- and intracellular membranes. Alterations in this gene may be involved in cancer progression. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 3 and 7. [provided by RefSeq, Jul 2013]
• Locus ID: 10061