MSH2 (NM_000251) Human 3' UTR Clone

CAT#: SC203467

3`UTR clone of mutS homolog 2 colon cancer nonpolyposis type 1 (E. coli) (MSH2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MSH2
• Synonyms: COCA1; FCC1; hMSH2; HNPCC; HNPCC1; LCFS2
• ACCN: NM_000251
• Insert Size: 273 bp
• Sequence Data:
  Insert Sequence

  >SC203467 3'UTR clone of NM_000251
  The sequence shown below is from the reference sequence of NM_000251. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCACGAATAAAAGTTACTACGTGAAAAATCCCAGTAATGGAATGAAGGTAATATTGATAAGCTATTGTC
  TGTAATAGTTTTATATTGTTTTATATTAACCCTTTTTCCATAGTGTTAACTGTCAGTGCCCATGGGCTAT
  CAACTTAATAAGATATTTAGTAATATTTTACTTTGAGGACATTTTCAAAGATTTTTATTTTGAAAAATGA
  GAGCTGTAACTGAGGACTGTTTGCAATTGACATAGGCAATAATAAGTGATGTGCTGAATTTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000251.1
• Summary: 'This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]'
• Locus ID: 4436