ADAM15 (NM_207195) Human 3' UTR Clone

CAT#: SC203551

3`UTR clone of ADAM metallopeptidase domain 15 (ADAM15) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADAM15
• Synonyms: MDC15
• ACCN: NM_207195
• Insert Size: 270
• Sequence Data:
  Insert Sequence

  >SC203551 3'UTR clone of NM_207195
  The sequence shown below is from the reference sequence of NM_207195. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACAGTGTCCTCGCTCTACCTCTGACCTCTCCGGAGGTTCCGCTGCCTCCAAGCCGGACTTAGGGCTTCA
  AGAGGCGGGCGTGCCCTCTGGAGTCCCCTACCATGACTGAAGGCGCCAGAGACTGGCGGTGTCTTAAGAC
  TCCGGGCACCGCCACGCGCTGTCAAGCAACACTCTGCGGACCTGCCGGCGTAGTTGCAGCGGGGGCTTGG
  GGAGGGGCTGGGGGTTGGACGGGATTGAGGAAGGTCCGCACAGCCTGTCTCTGCTCAGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_207195.1
• Summary: The protein encoded by this gene is a member of the ADAM (a disintegrin and metalloproteinase) protein family. ADAM family members are type I transmembrane glycoproteins known to be involved in cell adhesion and proteolytic ectodomain processing of cytokines and adhesion molecules. This protein contains multiple functional domains including a zinc-binding metalloprotease domain, a disintegrin-like domain, as well as a EGF-like domain. Through its disintegrin-like domain, this protein specifically interacts with the integrin beta chain, beta 3. It also interacts with Src family protein-tyrosine kinases in a phosphorylation-dependent manner, suggesting that this protein may function in cell-cell adhesion as well as in cellular signaling. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
• Locus ID: 8751