ADAM15 (NM_003815) Human 3' UTR Clone

CAT#: SC203553

3`UTR clone of ADAM metallopeptidase domain 15 (ADAM15) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ADAM15"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ADAM15
Synonyms MDC15
ACCN NM_003815
Insert Size 270
Sequence Data
>SC203553 3'UTR clone of NM_003815
The sequence shown below is from the reference sequence of NM_003815. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GACAGTGTCCTCGCTCTACCTCTGACCTCTCCGGAGGTTCCGCTGCCTCCAAGCCGGACTTAGGGCTTCA
AGAGGCGGGCGTGCCCTCTGGAGTCCCCTACCATGACTGAAGGCGCCAGAGACTGGCGGTGTCTTAAGAC
TCCGGGCACCGCCACGCGCTGTCAAGCAACACTCTGCGGACCTGCCGGCGTAGTTGCAGCGGGGGCTTGG
GGAGGGGCTGGGGGTTGGACGGGATTGAGGAAGGTCCGCACAGCCTGTCTCTGCTCAGTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003815.3
Summary The protein encoded by this gene is a member of the ADAM (a disintegrin and metalloproteinase) protein family. ADAM family members are type I transmembrane glycoproteins known to be involved in cell adhesion and proteolytic ectodomain processing of cytokines and adhesion molecules. This protein contains multiple functional domains including a zinc-binding metalloprotease domain, a disintegrin-like domain, as well as a EGF-like domain. Through its disintegrin-like domain, this protein specifically interacts with the integrin beta chain, beta 3. It also interacts with Src family protein-tyrosine kinases in a phosphorylation-dependent manner, suggesting that this protein may function in cell-cell adhesion as well as in cellular signaling. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Locus ID 8751

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.