ADCK2 (NM_052853) Human 3' UTR Clone

CAT#: SC204172

3`UTR clone of aarF domain containing kinase 2 (ADCK2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADCK2
• Synonyms: AARF
• ACCN: NM_052853
• Insert Size: 324
• Sequence Data:
  Insert Sequence

  >SC204172 3'UTR clone of NM_052853
  The sequence shown below is from the reference sequence of NM_052853. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCCTTCCTCCTCACGGGCCCAGTGTGCCCCCCGTGATGGGGCAGTGGCCTCTGTGGGCCCTTGTCAAGA
  GCTGGAGGCCACTCCCAAGAGCCTCTCCTATGGCAGCTGGGACGTTTTAAAATTGGGACACCAATTTCAA
  ATGTAACCCTCCAGTGGTGGAAGGCACACCATGGCTTCCTCTGCTTGGTTTGAGGGTCTGTTCAAAAGCT
  TTGGGCCAATTAGGGAGTAAAAGGAGGGAAGGGGCCTATCCATTCCATTGTGGAAGCTGGGCCAGGTGCC
  AGGGACACTCTCCTTCAGGGAAAATGTTATGTGGAGGAGGACGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_052853.3
• Summary: The function of this protein is not yet clear. It is not known if it has protein kinase activity and what type of substrate it would phosphorylate (Ser, Thr or Tyr). [UniProtKB/Swiss-Prot Function]
• Locus ID: 90956